Description :
From Genome Similarity Track
Location :
Scaffold_2811:426- 1856
Transcript NameFunction/comments
Phyta_totarag14857hypothetical protein PHYSODRAFT_563428

Sequence
1430 bases(100 bases per row)
GTTGTAGTACACCGTGTTCTCGAACTCCGGCGCGCAGTACGGGAactccacttcgtcgtccgacgGAGCAAACAGCTCCTTGCCCGTCGTGTAGGTCACG
TAGCAGCCCAACCCAAAGCagagcaccaccacgatgcCTCCCGATACCTTCTCCCACATGGCGACCTCGCTCCACGACTTCTTCAGGTAGAACACGATAg
gcagcaagatgcagttCACAGTGATGCACGAGGCACCAACGAAATCTGCCAGGGACGTGAAGTCGTCCTTTAGCAGGATCGAAATGACGACTAACACCAC
CACGATGATGACGCGCATCACGACGTACTTGATAGCGTTCGCACCGCGGTactccagcgcctcctcctcaaTGTTGTCCTTGTGCACATTCTCGGCGTCT
GCCACGGACACGTACGACATTTTGGAGCTGCGAACAGAGTCCTTGATGGCCGGATCGACGGGGGTAGATGCCTGCAGGTAGCTGACGGCGTTCTCCAGGT
CCTCCTGCACCCCCTTGTGCATGCCCAGGAACATACGCTCCGCAATGTAGAACGCCGGGTTAATGATCACGGAGAATGCGATCGTAATGTGCAGCTGCAT
GAACAGGTAGGCCAGCACGACTGTGCCCCAGTTAGGCGCGAAACCCAGGTTGGTGAGGCCGGTCTCCGAGTCCGGATAGATCGTAAAGAGCAGGTTGCCC
GAGATCTGGCAACCCACAGCCGAGTACGCCGTGCTGGCCAGGACCAGGAACAGGATGGAGATGACACCGACAGTGACGCCCACGACGCGCGGCATGCGCT
TGGGGTCGCTgtgttggcgctggatgtCGGGGATCACAATACCGGCGCCGTAGGCGAGCGACAGGTTGCCGAAGCAGCCGGCGACTTGCGAAAACGAGAG
ATCGGGCGTCGGCACGCTCGGGTGGCCGGCGAGACCGTGCATGACCACAGCCACGCCGAGGATGTCGGCAACGATCGTGCCCAAGCAGCCGGCGAAGGcg
gcaccagctccttcctTCAGGGTGGGGACCAAGCACACGGGTAGCACCATGAGCGCCATGAGGATGATCCACGTGGTCTGGCTGAAGGCTTCCGGGAAGA
GACCGTCAAGCAGCGAGCCACCGAGCACCAGGAAGACACACGGAATGAGCAGGCACGAGCCCATTTGGGAGATGATACACAGCCAGCGACCGGTCTGGCC
CATGCACCACTCACCGAGGTCTCCGAACGTCTTGACGGACTTGGGTGCGAGCAGCATGACCTTGGACATGGTAATGGATGCGTAGATATTGGCAAAGGCC
ATGAAGGCCATGGCGATCACGGCGAGGTAGGGGCCGGCGCGCGAGAAGTTGCCGGGCATACCAAGAGTTCCAACGCCGTAGATGCAGCAAAAGAGGTTGA
AGGCTGACTTGGCGTCCTCCGCAGTGAAGA