Description :
From Genome Similarity Track
Location :
Scaffold_9:425755- 428965
Transcript NameFunction/comments
Physo_159075PsAvh108
Physo_290099hypothetical protein
Physo_306693Hypothetical protein

Sequence
3210 bases(100 bases per row)
ACTATTCATACTACAGGTATTAATATATAACAGTGTACGTATGTCACACCATAGGGTGTTGGAGAAGATTTGATCTGTAAGGACTCATGACACGGGCTTC
CCTCTCGATAGGAATCCAACGATACCCACTGCACCAAGCAAACGTAATATACTAGCATCTCCATTAGGAAGCCAAACAGCTATTTGATAGCGCTTATTGT
GCTTTGCAGATAAAATGTCGCCCCGTTTTATGGCCTAGATCGAGGTAGGCCGGTCCACAAATCAGGGCACAAATCAGAGGGGGTAGCATGGACGATCTCG
ATATACTTAGATCGACCTCGAATTACGCTTTTGAAAACGCAAAAACGATCGATTTACCGACCTCGTTCTACTCAAATCCACCAGCAGATCGACCTCGAGC
CCTGATTTGGATTGTCGTAGGTCGAGTTATTAGCCGGCCTAAATAGATCGATCTGTCCCTTTCTTTGACCTTGTTTTATTTAATCGATCATGATTTATTA
TTACTCGAGGAGAGCTCCAAGTCAAAACGACAAAACGTTTGCAAAGCACAATACCAGTACTTTGATTAATCGATGTTTACTGTGGATTTGTGACACCTGA
CGGTATTTGAATTTGAATTTGTTGCTGTTTAGTCGGCTATCTACACCCAATGTTGACACCTGACAGTAGCAAGGACTGCCCTTCAGTATACCTACAAGCT
GCGATTGAAATCCCCTAAGAAGAAATTTTAGATGACATCAAGAGGGCACCTAACGAGAACTGGTTGCCGTCCTTGCATAGACGGTCTGTATGTTATCCTT
GAACGCTGGGTCTATGATAGACCCAGCGTTCAAGGATAACATCTCGGATCGGAGTGTACCGTACCGTACGGCAAATTACCGTCGGCAATCCAACCGTCAA
CAAGTACGTACAGGGCGTGGTCGAAATTACTCGATTGGCCTCTATGACCAGTTGGCAATTTGCAATTCGAAGGCTCAAGCATTCATCCCAGTCATCCGAC
CTCGATTCAGGATCATGCGCTTGAGTTGTGTTGTGCTCGTGGCCGTAGCCGCTCTCGTCGGGACGCTGCGCGGCACCTCGGCTGCTACTGACGGACAGCT
TTTCAAGCCAGTGACGATGAATGCCGTAGAGAGCAGAAGAAACGACCGGCGAGCCCTAATGACGCACCAGGGCAGCACGTACGAGGATGAAGAAGAGAGA
GGCTGGAAGGAGACTCTCACGGCTAATCTGATTTTCGCGAAGCTTTCGCTGTCATCGTTCGACACATAGGCCCGATCATTGCGAAAATCCGAGATGCTGG
TGTTCTAGCCGCTCTTTTCGAAAAAGTTGTGCCTCACATGAAATAGATTCTGCCCAAGTTTGAGGTCGGCATGTCAGTGACCAAGTTTGACGAGCTGCTA
CAAGCGTCCAAGCTGTCGGACGATGCGAAGACGGTGCTCTTAACTAGCTACGCGAAGTATTGGTTCACCAACCACTTTGTTGGATAGACATTATTAACTC
TTTAACTCTTTTAACTCTCACTCTTTCAGTATGGTTCAGAAATTAACTCATGCGCTAATATTCGCCGCCTCTGACATTGTTATCGATTTGAAAAACGGCA
GACACTCGCTTCACTGAATTAAGAACTCCAACGCAAACTTTTCACACTTTATTATATTCATTTGCATTTGCATTTGGTAGTAAGTTACTACTACAGTAGT
AACACCAGCAAGGCGTAGTAAAGGCTGCACTGGGAGGACACGTCTTACTTAGTAAAGTATTAGGCTTCTCTCAGTGTAGGATCGGTCAGCAAGAAGAGCT
CAATATCTCCACAGAGTGATCATGGAGTAAAATGGTGTAGGTGCAAGAAGTTTTACAAGGAAGTACGTAGTATTTCAGTAAGTGCCCAGTAATGCATTCC
TAGAATTTACTACTCCAGTGACGTAGTCTCCTTGGTTATACCTTGTCCATCTTCCACCTGGTGAGCACTGCCTCGCGCTGGTGCTGAGTTGGTCCATTGA
TCAACCCAACCAAACTCTTCAGCCGCGTGTAGCATTCAAGCACTGAACGGTCCCGTCTGGGCTTCCAGCCGGGCTCCACGAAGCGGACGATTTCATCCGT
CATCAAGATGGCAATATCGACGGCCTCCAGCAGGAGACTGGTTGGAAGTTGGTTCACGAAAGCTAACGTTTGCTTCGTGCGCTCTTTAATCGCCCAACTG
GCCAACCTTCCGAGTACTAGCTCCATCCGCTGAGCATCGCTACACAAGTGCAAATAGGTAAGTCTACGCTCATAAGGATAGCAGTTAAAAACACGTACCC
CAGTAAATTGGCCTTGACGGTGAAGTTCGACACTTTGCCAGCATAGAGCTTCGCACCTTGAACAAGACCCCGAAACAACTTGCATAGTCGGTGATTGCTG
CGTTCGCGCTCCGCCCAGTAAGTCAACGTGTTCATAACTTTCGACACGTCTCGGAATCGTTCGGAAGATAAAATCGGACGCATCATTTCCGTCTCCAGCG
CCTGGATAATCGGAGGGATAAGTGGGCCTCTTTTCGTGGGAGTCAAGAAGTTTGCTTCCCACAGCAGGATGTCATGATTCGTATCGGCTTCTTCATTTGT
CCTTGAGTGAGTACCACTAATTCCCTGGGCCACGCCTTTCAGGAAAGTTTGAAGTCTGGAGTGCAGTCTACAGAAAGCAAAATCACAAATAGTGTGTGAA
TTAGTACTACTGTAGCATCAGCCCATCTTACGGAACTCACATACCTTCTGACGCCCAAAGTCTTGCTGTCGTTCGGCAGGTTGTTGATCGGCGACCTTAT
AGCGTTGGCAAACTGTCGAAAAGCTTCGAGGTGGTTTTCTTGGTCCTCGCATCTGAAGGCCCACACCATCACAAACTTCAGGATGTTGGGACCGGAAACT
TGCAATTGGCTGCTCGAGAGCTGCTTCACGATTTTCTCCAGCTCGAGCAGTATCCCAGGCAGACAGTTATTTCGCTCCAGCACGTCCCACTTGTTTGACC
TCTGCCATGACTTTCAAGCAGTTGTCTTTGTTGATCTTGAGCGCTGAGGTTGCAGTTTCCATGTTGCTCTTGTTGTCCGTTGCATTGGCGTCCACAACTT
TTTCGCTCGACGTGTTTTGGTGTGCTAACTTTGACCCATTCGGGTTAAGTATCAGCGACGTGCCTGGCGTCTGTAGCGAATTGCTCGTGTTCTCAATGGC
ATCCGTCTGG