Description :
From Genome Similarity Track
Location :
Scaffold_9:425750- 426918
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G004192candidate a-L-arabinosidase

Sequence
1168 bases(100 bases per row)
TGTTTACACCACTGGCCAGCCAGTCGAGAAGTTGATCTGGTTCCACCCGAGCTTCTTCTGGCCGTCCGCATAGCCCACGCGCGTGTCCACTGAAGATGCA
ATAACAAGCACAACACACACAACCGTAAGCAAGATGTCTAAAAGCTCACAAGAGAAGCCAAATGCCGACCGGCACTTACCGTAGTGGTAGTACAGAACGG
GTCCGTACTTGGGGTCTTGCATGACACCCTGACCACCTGGGCCGTAGACGTAGCCGTGGGACGCGAGCACCGTGGTGCCGCCTGACTTGGTGCACGAGAC
GCCGTTCTTGTCGACAAACCCGCCGGTCGCCGATTTCGAGCGGCACGCCATGATCTTGTACTCGGCGCCCGCCGCCGGTCGCTTTTTGTCGTAGTTACAG
CAGCTGCCCTTGGAGAAGAAGAGGTAGTAGTACGATCCATACTTGAAAATGGTGGCGCCTTCCATCGCCGTGTTGACCGAATCGTACGCGATCTGGTACG
CGCTGCCCGATGGCTGGCTTGGTGAGCTCAGTTTCACCTGGTAGATATCTTTCCAGAAACTACCAAACGTAAGGTAGTGGGCACCGTTGACGTTGATATA
GTTGGCGTCGATCGCATTGTATGGCTTCGTGCTGTCGCTCGAGATGAGGGCAGTTGAGTGGTCCGTCCAGGAGCCGACTTCCATGGTCTTGGACGTCGCG
TACCCGATCGCGGACTCCTGAGTGCCGAACTTACTGATCGCGTAGTACATGTAGTACGTGCCATCGATGTTCGTAACATCTGGAGCCTATCAAGAGCAAA
GAAGCAACGCAAGTATACGAAATAGAGAGAGAAAAGAGTACGAGTGTCAGTCAGTTGCTTTTTAGGCTCCTAGTGGATGCACACAGCTTTCAAAGTTTCC
TTACCCACATGTCGTCTTTGCCCGTCCGGTTGATCTTGGAGCCACCCGTCATCGCGTTTCCCTTGTACGTCCATGGACCAGTCAGAGCTGGCGCCGAGTG
GACCGCGATGCCTCCGCCCGTCGAGAAGCGAAAGTACGTACCGTCCGTGCGGCGCACGATCGATGAGTCGTGGGCATTTACGCACACGCCCGTGCAGAGC
TTCGGGTTGGCGTAGGCGTCAACGAGACTTGCGAGCAGCGGCAATCCGAGGAGCAGCGAGATGAGCTT