Description :
From Genome Similarity Track
Location :
Scaffold_18:425710- 428629
Transcript NameFunction/comments
Phyca_LT153416178E set domain-containing protein

Sequence
2919 bases(100 bases per row)
catgcctgcctccaagaagcggattcagaaccgcggcacactcaatgtgggcacgcagcaagttccagcggcactgagggactgggtgcacatttggcac
ggtgtcaaggtgaacaacgggtcggaggacacttccatcttccacgcgggctcgcgtatcgaagagatgccgttctggaagcagtttatccggctcccgt
ccaattcgctgtttcctagggtattcacaagctccaatccgagaaaaccttacaaggatttcctctacgtgctgctaaatatgcgctggcccatgctgct
gacagttctgctggcaattttcatgctcaacattttccttttcgcagcggtcacgtgttttgtctgtggagagccgacacatttcttcgaggcctttgac
ttgagttaccagacgtttactaccattggattcggtgttgtgtatcctacgcacacgtgcgggaacgtgatcatgtccgtggagtcatttgcgtcgatga
tggtcgtgtcggctgttacgggtctcgtgttcgccaaatttgccaagccacaggcaaaagtggcatttagcaaggtttgcgttgtgcagccctacggtaa
aaagtatttggcacttgtcgtgcgagtggcgaacgctacgcagtcacgggatgtgacacatgatgtgataatggaggcagttttcaaggtcaacttgcta
cgtgtcgagcacaagacaaaacatattcgagcacacgatgatgaggtcacgatgaaacggagactttcccgtggcgcgaattgcatgatgccagatgaag
aaggcgttgtacatgattcggcttgctctccaactaaagtgctgacgtcgtacaacctcaagctgttgcagaataactttatcacatttcgcatgggcgt
cgcagtcgtgcatctcatcgatgaaaacagtccgctgtatgggatgtccaagaacgacatcgcccagtccgatatgttagtggaggtcgctatgtcaggt
gtcgactcaacattacaggacacagtgtcggagcggtacatctacacggcagcgaacttgatgtggggatatcgcttcgcagagttactggaattcaacg
aacgaaatgctgaagttattatgaactttgcgaaacttagcgcggtggaatccgccccaatcgacgatgtaaggtatctcaagccagttttctccagcga
taatcctcgagacaactttcaagacgatggtcatacacacaatgtggcccacagacgctcacatcggaaagcaagagtatctcagcacttagaagaaaac
cacccttaccatgatgaggccatccatgaagtgccttcggagtattccgagtctgttatgctcagttcgcgatcggggtctttagacggacagagtacaa
taacggaagatgctgcaccagctcacccccaccctcctgtgtcgttttcgaagaaacctgggccaaaaaagtttgctttggggcttgaaccactatttga
accattgctacaccagcccttcggaactcagcggataccgaaagctccatctgccggaagtaaggctgcagtgaggggaggtttgagagtttggaaagaa
aaggatcatacgaatctggaacaagggcgacgcaggaatactgtgcagcatataacttccagcggtggtgtgaatactcgtgtccgtcgtggtagcgcgg
atgcactaaacggtgacggtggcagggggtcatttgaaggcgcaaatggtgtacgagcgaagaatcttcttcaaaaagaaatggcggggtctgcattcat
cgacgatgatgccagtacaatttctcaagaagaaggccacaaggaagagttagacgggtgtgaagacattgacggtattgaggatatcgatgatgatgat
gatgatgacaacgacgatgacgatgacggggaagacgatgcgactcgacagcgtcgacgtgctctaactacgttgtccgctgtgtcaattgaggtagaag
atacgcctcgcttcttgcgcattctacctgttcacatcccaaaatcgttcagctttatgcgcctctaccagagcgcgcttcacgtccgctggcctaaaat
catcatcgtgtttgtgctatctttcctggtgatcaacttcgtctttggtctgctgtactggctggacgcggacaacatttcatcttacagcgatgtgacg
gtcaccaaatacgagctggcgttctacatgagtgtacatacgctggcaaccatcggctacggctccatggcacctatgcccaaggcagcttacatgaacg
tcgttgtgttcatcgagtcgatggtgggaatcattacagtgacaatcataaccggtatcgcctggtccaagtttgcgcgtcctagagctcacatccactt
ctcgtcgcagatgacgatctcaaccatctatggccaccgatgtctcgtgttccgagcagccaatacgagacactcgggcgaggtgcacgagaacttcttc
cgtattggtgtgatcctcacgaaccgaaggacagggctccgtcaaatgtacgacgttcctctggtgactgctgagtggccgtctatcaagcttcctgcga
cgctaatccacgtcatcaacgagaactcgccattctacaagtttcactctatggaggacctctcccaatcgcgtgtggcggtcatcgcgttgctcacagg
actcgatacgaccttttcggagaatgtgtatgcgcgcaagatgtacttctgggatgactttgcgtacgacatgcgctttgacgacttcgctgttattgaa
cgagaccgcgttattgtagactacgagcgctttgatcgcctcatccccgaggacagagaggagcaggtcagcaccacgccagtgctctccgtgagatcct
cactcgctgacttcgtgta