Description :
From Genome Similarity Track
Location :
Scaffold_38:425695- 427303
Transcript NameFunction/comments
Phyra_79297Hypothetical protein

Sequence
1608 bases(100 bases per row)
GCACACAGTGCATCGGTGTCAGCGTTCGCAGAGTCATCGGCAGATACGTACCGTAGCAATCCAAGCTCGGACGTGTAGCTTTTCTGCGATCCCAACAGCA
CACGCTCATAGCAGTTCAACGCCAATTTGCCCGCAAACTTACGAAGAGCAGGGGTTGCAATAATCGCAAACACATTGTAGACTGCTCCCACCAGCTTGCA
TTGCACTCGTTCATCTTTCTCGCGCCGAAGTCGCTCCATGAGATAATCCTGAAGCTTCACAGGGAACGCCGCAGCATCATTACCGGTTCGAATTGCGGTG
ACGATGGCTCGAAGCACCTCAGAGCAGGACTCTCCGTCAATACTGCTTGACGACTCACACGCACTTCGCATCACTAGAGGTGCCAACGCACTTTCGATAG
CCGCCATAGCAGTGGAGGCATCGATGCCGCCCAGGTGCCCGAGTACCGTGAACCCGGTCGTGAAAAACGACAGTTGGCGTTGACTGCTTTGGCTGTTCAG
AAGCTGCCAGAGTTTCCGCGTGAGCAACTTGGCGCGCTTGTATTCTGAAAACGAAATGTACTGAGCATGAGCGCCTAGGGACTCGAGCACCCTCTCGACA
AGCACCACATGCGGAGAATTGATAGTTGCCGTGCTGAATTCTTGCAGCAGACTGTCCAGTACTGGAATGCGAGCCCGAGGAGGAATACGCGAAGCTAGTA
CAGCCACGAGCGGCACGCCAGCACGCTGGAACATGCCACTGAAGTCGCATAGCGCCGTTAGATCCGCTTCAGGCTGGTTGCCGGAGTAAACTCGCAGCGC
AACAATTTCGACGGCTGACAGCTGTCGCCACAAGGCTACGTTCGAAGTGCTGGAAATCACTGTCCGCAGCTTGAAGAAAGTGCGCGCCAGCACTCCAGAG
ACTGGACCATCCTCGCCCGAGACGATAACAAGCGTCAGTAAAAGCAGCAGTAATTCGCAGAGCTGTGCCGGTCTGTCGTCCGAGAACTCGGGGTGGTTTG
AAGAAAAGAAGAACAGCAGTTGCTCGCACATGCGTGCTGCATCCGCCGCTACTACCTCATGGTCGTTAACTCGACGCTTCACCAAGCTGATCAGTGCTGC
CATTGCTGCGTTTTGCTCCTTGATTCCCTTGTTTGTGATGCTGAAAAGAAAGTGCTGGAGAATAACGTGCGCAGGAACCATCTTGGAAAACGCCTCGGTG
GCGGAAGCTGTGGCTGCTAGCTTATTTTGCTGCTTATTTTTCGTCACTGGTGAAGACGCAGACTTGAGTAGAGACAAAATATCCACATCTCCTCGAGCAG
ACAGATAGTGGAGTACCGGGTCAAACAAATCATCTACATCCGCGCAGTTACTGATAATATGGTCCCAGCTTGAAGCAAAGTCCGCGGGTGCCATCGTCAC
TAGCGCAGCAGTGAGAGCATTGGGGTCACTGAAGCGGTGCCACTTGGTGCTAGCCGCTCGCACTTTCTTCTTAGGGGTGGCAATTCTGCTTGAGCCATGT
TTTCCACATGTCAACGATTCACAATGAGCCTTAAGCCAGGTGTAAGCATCACATTCGCGCTCCATCTCATCAGAACCCACTGAGCGCTTCCGTTTCTTGC
CGTTCGAA