Description :
From Genome Similarity Track
Location :
Scaffold_198:42569- 49118
Transcript NameFunction/comments
Physo_144568hypothetical protein

Sequence
6549 bases(100 bases per row)
ATGCATCGCACCGTCATGAATATGGCGCGTTGCGTGGTTTTTGCGTGTGAACTGGCGCTCCGTTTTTGGGAAGATGCGGTGCAGTACGCGGCCTGCATAC
TCAACACAGCGCCGACCAACGTAAATCCAGAATGTGCGTCGCCGCTGAAGGTCCTGACGAAGGAGGCGTCTCAATGCAGCAAGCTCGGGGTCTTGGGGTC
GCCATGCACGGTCTACAGAGCACCGAGCAACAAGAACTTCTCGCAGAGAGCCCAGCAGGATCATCGGAATCGGCGAGGAGGTGAAGGGGTACAGGGTGTA
CTTGCCCATGGACAAGAAAGTGGTGACGTCTCAGCACGTGCAGAAAATCGACACCCTGAACAAGACTGAGAACTTGCAGGCGCAGAGACTGTATCAAGAC
GGGGGCGAAGCTGAGGCGGAGGAGGAGTCTAGTGAGCAGAGCGGCGGAGCTGCTGATAAAAACAGCCAAGAAAAAGAGATCTTAGACGAGGGAAAGACAT
GTGACTCGTTCAGTTGTGCAAGTTGTGTGAGTTGAATCGGCCGAGGCCGAGCAGCAGACTACGACTGGAGGAAACGTCGTGAAGAACGTGATGAAACGCG
GCCCCAGAAACTACAGAGAGGTCATACGCGGCCGACTCAAGGCCGCCTGGATAAAAGTCATAATGGAAGAGCTCATGGCTCTGGAGCACAACGGTGTCTA
GGAAGTGGTGCGACGGCCAAAGAACGCGCGCATCTTGCGCTCGAAGTAGGTCTTCAAGACGAAGCTGGTCGTCGAAGGGTTGATTGAGCGGCTGAAGGCT
AGACATGTAGCCGCGGCAACGAGCAGGAACTCGGCGTGGCGTTTGCAGCTGTCATCGATATGACGAAAGGTGATACTGGTACTTATCTCTAGTTGGAAGT
TTGCTCTGGATCAGCTGCTGCACCAGACCAGATATTGCGTACGCCGTTCACAAGTCGACGCGTAGGACGCATGCACCAACAGTTTCGAATTGGAAGTGAG
CTAAGCGCGTGCTGCGCTATTTAGCTGGAATGAGGTCGCTGAAGCTGTGTATGAAAGGACACGGTGGTTTAGACCAGCCGATGCGCGTGGTTGGGTACAG
TGATGCAGACTATGCGGCTGATAAGACTGCAGGAAGTTGACCGGCCATGCCGTCAGCTGGATCTGCAAAAAGCAAGGTGGTGTCTCGCTTTCCACGATGG
AAGCTGAGTACACCGCCGTGTCTGTGGTGGCACAGGAATTGCTTGGAGTGCGGGAGCTTCTGAGCGAGCTGAAGGTGTTGCTCGAGGTGCCGATGAAGCT
ATGCGTGGACAACCAAGCTGCGCTAAAGCAACTCGAAGGAGACCAGTCGTCAGGCAAGGCAAGGCAAGGTATATTGACGTGCGAATCAAGTTCGTCGGGG
ATTACGTGCAACGTGGTGGGTTGCAGGATGAATACTTGGAGACCAAGGAAATGCTAGCGGACGTGCTGGCAAAGGCGGTGTCTGCACCAAAGATGCTCGA
GCTTCGAGCTCGAATCGGGTTATACTGAAGTTTTAAGAAAATCACTGAAATCGTCAGCGAGGAGGAGTGTTGAAATGAGGATCTGTAGAATCTGCAGATT
CTACGATCAGGAGAGAGCGCCGGCCAGTTCAGACGGAGGTACAAGTAGATAAGCAGGTAGAGGCGGTAGCTTTCTAACCTCACTCTCCATTTTGCGTATC
AAGACACAGACTGCAAGTTCTAACGTTTCTTCCAACAATAATACTACAGTAGTAACTCTAGACTATCAGACAAAGCTCTGAAATTTAGTAGAAGCATGTA
TGTAAGGACCTGGTCGAACGTTTTCTGGGGCTACTGTAACCTTATTGTTGTAAAGCCCAGTTACTCTCTACAGCGCTTCACCTGCGCCTGCTTCGCAGCC
GCAGGATCTGTTAAGCTGACATTAATCTTAGTCTTAAGTTATCGTCGGTGTTGGGTGTATTGACGCTACCAAAATGCACCGAGTTGAGAGCCCTATGCGT
GCTATCGGTGAGCTGGTCGACCTTGGAGGAGACGCCGTCGACCGCGCCACTACGCACTGTTCGCGTGCATGATGCCGGGCCGCAAGGACCTCAAGACCAC
CTGCAATTTCATCCTATTGGGCCACATGCAGAAGTCGGGCTTCGCTCCGCCCTTAATCGTCATGTGCGAGAACATAGTTGCAAGCATCCTAGGTATTAAC
CACTTGGGGGGGGGCTTCAAGTGTAGCTCATGTATATGGGAAATTGGCTCACTGTATATGTAGTGTAGTAGACCGAGTAAGTACCGTCAGTAATACTATT
TTATGTAGCATTAATTGTGCGCTGCCTGCACGTATTATCGGTAGTATTGGTAGTACTACTACAGCTCCACAAATAACTTGAAATTTGTAAGCACGCGTCT
TATACTACTGTAGCTAAGTTGATGTATTAGGCAGAGTCGAACCATGCAAAAAAGCTGCTCAGAAATCTTGCCTGTTCATGCTTCCTTTTACGACAATTTT
ATGCTTAGTTTCAAAACAAGCCACCTCCGGAGGTGGCTAATACGTCAACTTTGGAGGAATTTCCACAAATCAGTAATTTTCACTGAGATTTGACAAAACG
ATTGTGATTCTTTGCCTGAATTCACTGACGCAGCTACTTTCGAAGTTCAATTTCGACCCTGCGCAAATAAGCAACGTATTCGGTGCCTTTCGCCAGAGGG
CCACCTGGGCAACCATTTTGAGGCGAAACAGCGCCTCAACCGGCCGTCATCGACACGCGGAAGTAGATAATGGGCGACGACACTTTGGCGTGCTTGCGCT
GCCACAGTACCGCTGCACGTCTCGCGCCAACATCGCCGTCGGCGGCAACCGTACGGACACCATCGAACGCGCTCACGATGGTGCAAATGGGCACTGCGTC
TGCCACTCAGATGTCACAATGCGCACGCCCGAGATGACAAGTGCTCCCTCGCTGTGCTGCCCTTCGTCGGAGGGGGGGGGCAAACTGTCTACTAAGTACG
ATAATATTAGAGAAAGTTCGACACTCTCCCCTTCGCGATTTCTGCTTACTTTTGCGTAATTTTTCTGCTTGCCAGTTCTGCACATGTGTGCTTAGTGTTT
CTGCTCAATTTCGATGGCTCAACTCCGCCTATTGTATATAGTCGGATAGCCCAATCTTAAAGTAATCGAATAAGAGTGTATTAATGCTATTTACGAGTGA
TATTCATTTCTAGCTTTTGATGTCCGGTTATGTGCGAAAATGGATTGGTCCACTTAAAACACGATTATTTCGAAAACTCGAAATGGCGCCTGAGCATCAT
TTTGTTTTGTTTGAAACCGTCTCATACGCGGTTTGATCGTCCGCTGTAGAAATACGCTTAAGGGCCGAAGTCAAAAAATATTAAAAAGTTTTAGACGTCT
CACTTCAACAGTTATTGCGATTCACTACTGTAGGATTCGGTGGACTTCCGTTACTGGGTTGTGTTCGTAGTTGAAGGGCTCTTGCTGCTACTGGTGGTTG
TGCTGTTGAAGGAGCATTTAGTGGAGGTGATCAATCTCGCACCACCGAAGGTAAGTTCTTCGTCCCCTACCATGAGGGCAGCACGAACGTGTTGAAGGTG
CTCGAGGTAAGTTAAAAGCGGACGATTTTAAGAGCGACCAGATGTCGCAGGTGACCGACGTGGACAAGACATCCAGCGATACGGAGCCAAGAGCACAAAG
ACGATCAATCTGACTTGATTGCGTGGCACTGCTGGCTAGTCCATCGTCAGTATTTAGGTAAGATTTTGTGCGGAAAAGAAACCTCACATATAATGAGTAC
TAATGTTTCGGTTTGTTGCTTTAGTCCGTGCCAGTATTGATGTGCAGCTTCAGCTAGGTGAAGACCAGTATCAACATGGTGGAAGCAGTGACGTGACAAC
ACACTTATCCGAATACCGTGTTCCCTCTACTTGAACTCTATGCTTCAATAGCGCTCTGTTCCCTTGCTCACGTATCCGCGTCGGCTTTTGTATACAGCCA
TTGCTTTACTGGGCCGACCGGATAGCCCCGATCTAGATGGAAGGTATTAAATGATATTTAGAGATGACGCCGTCTTTACAGAGGACTACCTAGGCATTTT
CCGGGGCGGTAGGACTGGGGTGGGGTGGGGTGATACGACCGTTGCAAGCGAACCATGTCCGTTTACCGATGTACACTGGAAGTCCCGTGCCGGTTACAAT
TTTCTTGGTCACGATTGCCACCACGTTTACTGCCTTTCGATTCAGCATATCAACAAATACTATGTTTGGCTAATGAGCCAAGCGGTAATATCAGCTTCAG
GGTCGCGATGTAGACAAGCTTCTCAGTCGCAAAAGGTTCGCTTTAAAGAATGATGTTGCTACTATTCTGCTTAATTCGCACAGAGCTCCCGTGAAGTTTC
TAGCAATGGCGCCATTTTCTAGAAACGGGTCCGATAAAGCACCATCGCCAACCTGATCGACCCCATACCTGTTCACTGTTGTAACCTTCTCCCATGTTAG
CCCGCACCCTCTCCAAATCACCTTCCCGGGTAGCTTCTGCCATAGCTGTAATCTCTGCAATAAATGCTGCGCTGATCATATCTTTACACAAGGTAACATG
CTTGGACAATTACTCCTCTGTAATCTTGTTGCAATCTCCTTCAGGTACAATTAGCACGCGACCAATCTCTATATTGGTATTGCCCGCTTGCCCAGGCTCA
TCACTCATTTTCGTAGGCGTTTGAACACCCCATCCGCGGTTAGTGTAGCTCGTCAGATCCTCTCTGCCGTGTAGCACAACGCTAGGAGAACTGTGCGGTC
CTCGTCAGGATTGTTGCGAATGATCTCGTGACGTTCCGCCTTTTCTAGCTCTTCTCAGCGTCGGTGCAAGCCTTTACCCACACGCTCCTTCAACCATGAC
TCGGTGCTAGCCGCATCGTGTCCGTCAGTGCGCGAACACTGCGGCTTGCACGGAAGCACCGGGACGCGGCCACTGGGATACCCACCCGAAAAAGGGATCG
CGCTTAGAAATACGACGGAGCCGAACCGCGCGGTGATCCGAGTAGTAAAGGCGATTTACAGTGTAATTTGCCGAGATTGCGCCTCCGCTTCAACGGTTGC
CCGACGCAATGCGCGACACGTTGCTAGCCGCCATCGGCCAGACAATATAAAAATAAAAAGTATCCTCAACTCGACTTACCCCCCTGATTATATCTGGCGA
GTGGCAAACATGCAGACACCAGCCTTGAGTATCCGTGTGGCGTGCGAGATATCGTGCAAGGACTCTTCGCGTCCGATGAAGAGCTCTCCCACCACATCCG
AAAGGAGGGGTACTTCCCCTACACTGCTGAGCGTCGGTTTCATGCCCCCGTTGCGGTCCGCTTGCACTATGAGCAGTTTTTTTCAGAGCAAATAATTCGC
ACCGCTCGTCCCGCCCAATGCCCTTCACGCGCTTCCTCACGAAGAAGAACATGTCCACGGATCCGTTAAGGTGCTTTGTCCCCACGTCGAGAGTGTTAAC
CCCAGAAGGACCAAGGTTGTATAGGGCAACGTGTGAAAGTGAACAGACCTTAATATGTTGTAGGTATAACATGTTAAGGGATGTACATTAGTGGGAAGGA
TGATAAAAGTCTAGATAAGAGGCTTTGAGGATAATATATTTGATGGCATAAAGTATGCAGGTATGTGACGTATAACCGTACTTATTACAGACCATACTAA
AAAGAAGTGTTATCATGGCCTTAACATGGTGTATATTGCAACATGTTAGGCAAACGAAAGGTTATATAAGTCGGCGTGGTCCTTGGGGGGGTTAATGAGG
TCCATAATAGGGCTCTGCGATACAGAATTTGACTTTGGAGTACGCTGAAAATGCGGCCCTTCTCCTCAATCTGCAGGCTAAGCTGCTAGTCAGGCCTTCC
GAAAATTCGACTGCAATGACATTTAAGTCAATCAGCAAAGTAACTTATTGTAGGGAAGTGCTTGGTACGGATACATACATTATTCCTGCTGATCGCGCAA
TATCGTACCACTAAGTCCTGCATCTCACTTTGTAGCGTTCACTACGTCTGCTACCGTCTTCACACCCCACAGCTGCCGGTTCACCTTGAGGAAGAGAATG
GTCTCCAGATGAACAGGAAGCAATCCTTGCCTGTGGCTTCCCAGGACATGCTTTGCCTGACTGAAAAAGCGCTCGCGGATGTTAGAAGTGGGGGGGGGGT
ATCACTGCGATTTCAGGGTACTCACACGGCTGCTCACGCAGCATTCTGCGTCTTTTTAACGCTCGATCCGTGAAACCAAGTTTTTTGTTCTCCACCACGG
GGGACGAGGTTGCGGGGACGGAAAAAGGTGCCAGTAGAGCTCGTTGCTGCGCTGTTAGCAAGTCCGTCTTGTTGAGAAGCACACCCACGCAGGCGTCCTC
GAACTCAAGTTGATGAACGACAGCATCGTCGGTTCCCAGGTGGCTTTCAACACCAGGGTGCTCAGCGATGAGAGCATCGAAGATGTCGCGAGCGTCCAGC
AGCGACAGCCCTTCTGAGCTCTGTAGTTTTTTGGACGATGACTCAAATG