Description :
From Genome Similarity Track
Location :
Scaffold_8:425594- 428155
Sequence
2561 bases(100 bases per row)
GCGCGCCTGACGCTGCTTGTTCATGTCTTCCAGGACGTTCTCGTCCAAGACAGAGGAGGAGTTCAGCTCCTCCTGAGTGGTCTCAGGACTCATGAGTACC
ATCTCAGCAATCTCTCCAGCCTTGAGGTTGGCCAGGAAAGACTCAGCCGTCATTTCCTCGAGGTTCAGTATCTCCGCAACCTCTGGCAACGGCTCCAAGT
GGACACCAAATGCCTTGACGGGTAAACCTGTCTCGCCATCGAAGATGTGATAACACTCTTCCACCGGCCTTGTCGGAGGAACCCGGGCCCTGGCCTCCGA
GTCGCTTGAAGCGACGTCGATCGGAACGAAGCTCGGATCCGACTTGAGGCGGCGGCGGTGTCTTTGCCGACGGCGTCTGTGACGGGGAGCTTTGCTGCCC
ACGTCTAGGGATGTCGTCGCTACGACATCCGAGGCACTCGTGGCCTCGTGTGATACTGTTGTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAG
TTAAGGTCTGGGCGACCGCGTGTGGCACTGTGTTACCCACACAGGAAGCGTATCCGACGTCTTCCTCTTCAGTTAAGGTCTGGGCGACCGTGAGTGGATC
TCTGTTACCCACTCTGAACACGCTGTTCTCAGTGTTCATGACAGCTGCAGCTGTCTGCGGAACTAAGTTACCCACCTGTGGACCTAAGTTACCCACTTGG
CCGACGCCTCTTCTGGGCGCGGCCACCATCAAAACATCCTGGGAGTCGTCATATACGTCGACGACTCCCAAGCATCTGCCGGATGCTTTGGTACCCTGGC
AGCCCTCGCGGGCGCCCCGGGTCCTGACAGAGGTGGGAACATGACTCACCAATGCTCTGTCGGACTGCGCAGGGCGGCTGGCACCGATTGCCTTGCCTCG
CCAGTCGATCCTGGGCTCGTGCTTCTCAAGCCAGGGCATGCCCAGGATCATATCATATGGATCCATATCGAGAACAGTGAACTGTTCGAGGCTGTCAAAG
TCTTCAAACTTGACAGCCAGATCCACTTGGACGTTGGGGACAGTGACGACCTTCCCGTCGGCCAGTCGCACTGACACCGTCCCGTTGCCCTTGCTTTCTC
TCAAAGCTTCGGACAACTTGTTGCTGTTACGAGCAACCGTCTGGCGGCGTGCGAAATTATCGACGCTCCAGAGTCAATCAAGATTCTGAAGGAATGATCG
TATCCCCGTACACATCCGTGTACTACGAGCAACCCGCCGCTGCTCTTCGCGGATTCAAAAGTGCGAAGACTCTCAGGGGCTAAGTCCCCGTGGTACGCGC
CACCCGCGCACCCATCACGAAGACTTAGTTCTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTCCCTGCGTTCCCCTGTCCCCGGGATCCTGGCTTCTGC
CAGCGACCCTTGAGGACGGGCTTGGGGAAGGACCGTCTGCGGAGTCTTTCCGCGGGACAGTCGCGCTTGAAGTGGCCCATCTTCCCACAGCCGAAGCAGC
GGATGTCACGCTGTTCGGCGGACCCGAGTTCCATGGGAACTGGTCCGTTGGGGCTTTTTCGACCGGGAGCCGACCAGGAGCTCCCAGGCCACGCTGAGGC
TGGCGTACGCGCCTGGCAATGGCTGTACTCTTCTTGAAGAGCCACTTGAATCGCCTCTTCAAGGGTGCTTGCCTGCACCCGGAACAGCTGAGTGCGTGCG
GGGCCCACTCGAAGGCCGTCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAA
AGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTC
CCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAA
GCTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTTGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTAT
CGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCC
ACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGATACGTCAAGACATGTGAAACATG
TCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTATTTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGG
CTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATAGTACATCTTGCTCCAGTTCCCGTAACGGGCGAACAAA
CCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCTGGAGACGATTGTCTC