Description :
From Genome Similarity Track
Location :
contig_32:425503- 427258
Transcript NameFunction/comments
g7360.t1RAW32288.1 hypothetical protein PC110_g11370 [Phytophthora cactorum
g7361.t1XP_009520925.1 hypothetical protein PHYSODRAFT_481470 [Phytophthora sojae

Sequence
1755 bases(100 bases per row)
TTGCTGGGCCTTTGCAACTGTCGCCGCGTTGGAAGCCGCACAGTGCATTGCCAACGGCGACAAGAAGGCGCCGTCGTACTCGGAGCAGCAGCTTGTGAGT
TGCGATACCAAAGACTTCGGCTGCAACGGCGGTGCCCCTGTGTACGCAATGGAGTACGTTCGCGACAACGGCGTCTGCACGAAGAGTAGCTACCCTTACT
CTTCCGTGGACGGCGGTACTGCGGCCGCGTGCTCGACGTCGTGTACCCCCACCAAGTCCGGCATCTCTGAGATCGTGCAGCTCCCCACAGGCGACGAGAG
CGCGCTCCTGAGCGCCGTGAAACAGCAGCCCGTGATCGTGTCCGTGGCGTCGGACAACAGCGCCTGGAAGCAGTACGTGAGCGGCGTCATTACGGCTTGT
GATACCACGACGGTGGACCACGCCGTGCTGGCCGTCGGCTACGACGCCACCACCATCAAGATCAAGAACTCGTGGGGCACGGACTGGGGCGAGGATGGCT
ACGTCCGCATCAGCCGCAGCACGCAGAACAAGGGCACGTGCTCCGTGCTCACCGACATGTCGTACCCCAAACTCTAACCGTCCAGCAACACAAAATATAT
GTCCCTAAGTGAGTCATTCAAAAAAGGCAACTTCAACTTGCATTCTGGGTACCCTTACGTAGCCCTACGTAACCCTACACATAACATAGCTAGCATAGAC
CAGTCTAAGAAAAACATAGCCGAGTGTATCCTCACCTGATGCCCGCGCTGCTGCGCCTCGTATCCAGTTCCCGAAGCCGCCTCGCGCTGCGCACCATGAG
CTTGACCCCCCGCCGCTTCGCCTCGTCGCACGCCGACGCCAGGGCCACCGCGCTCACGCGGTTCGTGGACGAGAACGGCGCCATCCGCTGCGGTCAGCGC
ACGGATGACGGGTCCACGGCGCTGCTGGTGGAGGACGACGACCCCCTGGGCAGTCTGAGCTTCACAGGCGAGACCGCCACCATCGAGAAGGTGCTGGCGC
CCGTAGTGCCGTCGCAGATCCTGGGTATCGGCCTCAACTACCGCAAACACGCCAAGGAGACCAACATGCCCGAGCCAAAGTTCCCCGTGCTCTTCACCAA
GGGCGTCAACGCCTTGCAGAACCCGCACGACCCCGTGGTGATCCCCCGCGTGGCGTCGGAGCCTCCCGAGGTTGACTACGAGTGCGAGCTCGCGGTGGTG
CTCAAGGAGGCCTGCTGCAACGTGACGGAGCAGGAGGCGCTGAGCTTCGTTGGGGGCTACACGTGTGCCAACGACATCTCGGCGCGTCGCTGGCAGGGCA
AGAAGGGAGGAGGCCAGTGGTGCCGCGCCAAGACCTTCGACACCTTCTGTCCGCTGGGCCCCGTGCTCATGACCCCCGAGGTCATCCCCGACCCGCAGAC
GCTCGAGATCGCCACGTACCTGAACGGCGAACAGGTGCAGAAGTCCAACACGAGCGACATGATCTTCTCCGTCGCGAAGCTGATCAGCCAGCTCTCGCAG
GATTGCACGCTGCCCAAGGGAACGCTCATCCTCACGGGAACCCCCGAGGTGAGGGACTGTTATGGTGCGGTTTTGTTGTGTGCGGTAGGTCTTAACTGTG
TTGTGGTGTGTTACTTTCCAGGGTGTTGGCGTCGCGCGCAACCCGCCTCTTTACCTCGCCCCCGGCGACATGGTGGAGATCGAGATCGAACACATCGGCA
AGCTCGTCAACCCTGTCGTCGGCGCCTCGGCGCTGTAAGCGCATAAGTGGCACCC