Description :
From Genome Similarity Track
Location :
Scaffold_49:42547- 43855
Transcript NameFunction/comments
Phyci_579579Hypothetical protein

Sequence
1308 bases(100 bases per row)
CGCACCCAGCATTGCGATGTTGCATAGTAGCCAGTTAATCAAGATCTGGTCGTGTGGATTCGTCTTCATCGCGCCAATGTTCCACGCAACTGCAGGGCCT
GAATACCTTTGTAGATTCCCGCGAAATACCCACACGCAGTTGCGCTTCTATCGGTAAGTGCGCCCATATACCAGTATATCCAACCTTGCCACAGTGCATC
ATTCCAACCGTAAACTATGTAGAGGAAAAACGGAGGAAGAAGTGTTGGAAAATCTTCGGCGATATCAAGGTTCTGTGAGGTTTCATACTGCAAATTCATG
TCAGACTGCAGATACAACCCGGCCGCCCACGTGGTGTTTGTCAATAGTGCAAAAAGGACCAGCGACCGCACAGCAACGTCCGCCACGACGAATTCGACCT
CTTGTAGTCTTGTTATGCTCTCATTTGTATGGCTTATGTTTCTTCTCTTGCTGACTTGACCACCCAGAGTTTTGCCGACTGCGTACGCGGCTCCCATTTG
TGCCAACCAGTAGAATGAACTCGCCAGTCCGCTGGTACGTACATTGAACGCAGTCACGTTGAAAAAAGAGTGATACGCATAAAACCAGTTGCTGTATGCA
AACAGCGGCAGTAACCAAAGAATGACACGTAGTTGCTTCGTCGCCGTCCTATCAAACTGCTGTCTTAACTGCACTCACAATACTTCCACGGTTCCACTCT
CTTCATAAAAATCGGCGGGAGTTGTTCCGTCCTCTCGAACAACTTGGTTGGAGTCAACAATACCAACAACTACGAGGAGGATGCCTGCGCACATCCGTCC
AACGAATACAGCATACATGGTCCCCGATGGACGCTCTGTCGGTGCCCCATACCTATCAGAAAAATTTAGAGCAAAACCGATGAATCCACCGGCTGCAGCA
CCAAAAATGAAAATGATCCAGAATGTACTCACGTACGAGCCTTGATTCGTCGGTGTGGCGTAGCTCATGATCATTCGTCCTTGGGCTGTCCACAGAATCC
CAGCCGAGATTCCCAAAGCAACGCAGCCCGCGTAATACATTTCCAAGCGGGAGTCGAACCCAGGAGTCTGGAGATTGGAAAGTGCCACAGTGTAGCAAAC
ATAACCCATGGTGCCCAACATCAACGCTACTCACACGTTCGCAATACGACCGGGCAATAAACTGCAGGTTGCGAAGCTCAGGTACACGATTACATTCCCA
CGATAGGCAACAACAGGGTCTGGCAACCCCTAGCGAACGACGTTAGAGCGTTAAACAGGCCTGGGCACAGAAGCAAACCAACGAGAGAATGAGGATCTGA
ACGGAGGC