Description :
From Genome Similarity Track
Location :
Scaffold_269:42529- 44875
Sequence
2346 bases(100 bases per row)
TAAAATTGATACGAATGTATCAATTTTTGAATATTACCTATTGAAATAATATTCAATTCACATCACTCGCGAAGATGTGATGTTGACGGAATATTACCCC
CGAGGGTAATATTCTGGGTTGCTCCACTTTTGGTTGATGTAGACACTACATCAACCAAATTAACCACCAATCGCTGCTGGACGCGCGCAATGGGTGGTGA
GTAAGAAACCCACATAGGAGATTGTAGTTTAATATGGTTAGATCAAGACAAAGATGATTTACAAAGAAACTTAACTATATTAAATACGGTTCTACTTTTT
CCCTAGACAGAGCTTTTAGTTCTGTTTACTTCGCTGCGCTTCCTCACGCCACGTGTACGTGACGTCGGGAGTACGCAGCCTTGTGTTCAGTCAACACTAG
GCCTTACCAGTCATCTGGTAAGGGCGTGCCCCGTTACATCTCGTCCCATATTAAAAGCAACATGGAAGGCTTAAACCAGATCACAAGAGAGCTGTTTGTT
TCTGTTGACAACGCGTGTCACGCGCTTGACGAGCTGGCACTGCCGGAAGGCTATGTTACAACTATCAAACGGCAACTAAGGGTGGGTAACAGCAAGGACA
GTGAGGTTAAAACAGTGAATCTGCAATGCTCGTGCAACGCTGTCCACAACGGGCGATTGATGAAGACAGTTAAATTATAGCACTAAGCACAACTAGAGGG
TGAGCAGCATAAATCATGTGTATTCTGTTTTCACGATCGTCTATGTACCCGTTAAGGCGGAAGATAGTTTGAATACGTTTGTACCATAATCAAAATGCCG
TCGTCGGAGATTTTCATATGGCCCTAATAGGGAGAGACGTGGTGTAGGAAGGGATTTTATTCACCTTAACCAAGCCAGTGTGAGCCTATAATTAGAGTGA
TCTCAGTAGTTCGCTGCCCTATGCAGCAAGGAGTGTGAGTGACTTTAATATGTCAACACATTGCTGTAGTGACGACCGCAAGCGCGGCCGATCAACCCGG
TTTACGCGACGCCATGCAATGTGCCAAGTAGAATGAGCGCTTCATCGGCTAAATTCGTTCTTTCCATCGCCTAGCGCGTCCCAACGCCTGTGTGTGCAGT
CGCCGAAGCGAGCGCGAGACGTGGGGATGTCAGCCAGCCATTATATCCTCTGGTCTACTGCTGGCACATTTTGCGGCTGTGCCAGAAGCATTCACAATAC
AATGACTTACCCGCTTCGGCTCTTGTTAGGAGGATACCCGTCGAAGGGGCTGCTCTATGTGGAGTTGCGGATATAAATCGCTCAGTGTTGACTGTAAAGA
TTTCGAAATTAAAAGCATAAAAGTACAGCAATACAATTTAGAGGGCTTCAAAATTAATTCCTTGATTAATGTATGTGATGAAGGCTCATTACCGAAAACT
AAGGCTCATTAGCGGCTCCCTTAACATTTATATTTGAGCATATTTAGATTGTAAAAGTAATCATTAAAAATATAATATAAGATTTAGGGTTTTGCTTTGA
GAAAACTCTATTTTTACCACAGTAATCGTCTTCAGATGTATTTCGTTATTAGAACCAGAAACCATGGCAAACACAGCACAAAATCCATTGAGTGAAATTC
ACTCAATGGATTTTATAGGCTTAAACCCAGCGGAACAGAGTGGAGAACAACTCGAAAACACAAGTAATATCCCAACTCACTGATTGATGTTAGGTAGACT
TATAGTGAGATCCATTCACCTACGGATTAAACAAGAATGGTAGCATTTTAAAATATATGCGGTTAAGCTTCAAGATAGTGGGGCATGCTCTAGAGGTCGA
CCTTAATATGAATATTATAGTTCAAGGAGATGATTAAAGCTCTTTATACTTACGTTTTATTTCGGGTGGTCAGAAGATGAGGAATGAGTTGTGCACCTTG
AATTTGAAAGAATATGCAGATAGGTGTTCGTGAGTTAAAGGCAATCGTGAATGAAGTTGATTTTTTGTTAGAGACGATTATGGGAATAGAAGGCAAGGAG
TGTTCTGCTCGGTAGATCCGTTAACCACAAAGTGCGGCCGACGACATATGTTTGATCCATGTACAAGACAAATTAAATCGAGAGAGCATCCACGGCCACC
GAGAGCGTAATGTGACCATGAAGTTATTACTATTTTAGTTATTAAGTACCACGAATAAATTATTTTCCATTAACTGTTTGCCTCGGGTACGAGACTTGCG
CTGCCCCTATGTGTCGAGGGTTTGCCTATTTGCCCTTTGTTCGATCTTCATCACTTTTGAGACAATGGCGTGATGGCTTTGGTGCGTGTGTTTGATAAAT
ACTTTACGCGGTTGAGAAAACTTCGCGACGCGAAAAATGTATATTC