Description :
From Genome Similarity Track
Location :
Scaffold_248:42524- 46820
Transcript NameFunction/comments
Phyin_T30-4PITG_20953Aldose 1-epimerase%2C putative

Sequence
4296 bases(100 bases per row)
TCTTACCTCAAGACCAGGGAGAAAAGGTATTTCCGAGCCTCTCCCCCACTTACACTCGAGACTATTGAGTCTCTCGTGGCTTGTGATATCCACTGGCAGC
ACGACGGCTACCTGCCTCTTGGAAAGTCAGGGAGGAAAGGTATTTCCGAGCCTCTCCCCCACTTAACCTCGAGACTACTGAGTCTCTTGTGGCTTCTAAT
AGCCACTGGCAGGCGCAACGGCTCTCCGCCATGTGCACTGCGTCGGTATGGCCGACCGCGTCGGCCGTGTCGACTGAAGGCATTCAGCCTTCGCGTCAGC
AGTTTGAGTCTGCGCGACTTGACGTCGAGCGAGTTGCTCATGTCTGGCGAGGCCAAGACAACCTCGCGCCTCGAGCCAATGGCTCTGTGTGCGGCGCTAT
GTTACTCGCCGTGGGTGTGGAACTCTGTTACCCACACCGGAAGCGCATACAGCGACTTCCTTGTCAGTTATGGTCTGAGTGACCTTGCGTGGAACTTTGT
TACCCACGCTCGGAGCACCGAATGTCGGTCTCCTTAAGCAGCTTCACTGCTTGCGGAACTTGTTACCCGCAGTGTGGACCTATGTTACCCACCTGGTGAA
TGCCCTTAGGCACCACCACTGTCGAAGCGCATACGGCGCGACGACCTTCGGTGTTGGGATCGGCTGGTGTGGCAGACTCGCCCACACACCGGACAGAGTT
GGTGTCCACCGACCGAGTCAGAGGAGTCCGGGCCCTGGACTCCGAGTCGCTTGAAGCGACGTCGGCCTGAACAAGGTTCAGACCCGACTTGCGGCGGCTG
ACGTGACGTGGCACTTCGTTACCCACGTCGTGATGTCTCGTTGACGACATCAGAGGCACTCGAGACCTCGTGTGGCACTGTGTTACCCACACAGGAAGCA
TGGACAATGCCTTCCTCTTCAGTTATAGTCTGGGCGACTGCGTGTGGTACTGTGTTACCCACACAGGAAGCGCATTCAGCGCCTTCCTCTTCAGTTAAGG
TCTGGGCGACCGTGTGGTCCTAAGTTACCCACCTGGTTAGCGCTTAAAGGCATAACCACTGTCGAAGCCCGTACGGCGCGACGACCTTCGGCGTTGGACG
CTGCTGGTGTAGCAGGTCCACACGCCGGGCAAAAGACCCATGCCCGTGGCATTGCCGCAGCGTAGCATGGTCTTGCTGTACGCAGAGCTGTCGGCGCGTT
GACAGCTCCGTGACGCTTCTGCGTCCTGGCGGTCTGTATCAGACGCCCCAGTCATGACGGAGGTGGGAACATGACTCACCAATGCTCCGTCATAGACCTG
GACTGGTAGGCCCTTCTCAGCCTTGCCACACCAAAGTCCGGGCTGTGCCTTATGTTCGGCACAGCCATGTTGTTCATGGCGAGAACTGCGAGCGACACCG
CGGTGCGCGAGCTCATCGAGCCAAAACGTTCAGGTCCGTTGAGGACCATTGATACTACCGTACCAAAGGCTAGTCCATCAAGGACCAGCCCATGACCGCC
ACTCTGACATAGAGTGCAGTCGGATGTCGCTATGCCAAGCGACGTTCCAGCGGCGTATCAACGCCCCAGAACTCATCAAACGTTCAAGGGGTACCGTACC
CCCGTACACCGAGTGTACTACCAGCAGCCCATCACTGCCCTTCACCGGTTTGAGAGAACCACGTCTCTCTGGGCTAAGTCCCGTGGTGTGCACAACCTGC
ACACCCATCACAAAGACTTAGCGCTTTTCAGTAGGGCATACCGCCTCTACTGGTGGCCGGGAAGTCTTCGTCCACCTGGCCGTGGCCTGCGCCACCGGAC
TTGGGGCCCACGGGCCGTCTTCTTCCCGAGGACTAGCGAGGGACACACACGCTGGTAGTGTCCATGTCCGCCGCATCCATAGCAGCGGACCAAGCTCTCG
GCTGAGCTTAAGTCCATGGGCTTGGGCTCGCTGTACGCACCGGTATCAACAGGCTGCGTGACAGCAGGAGCAACAGCGTCATTGCTGCGATGCTCCGCCT
CCCGAGGAACGCCATTCTCATCGTGGCGATGTTCCTCTTCCCGAAGAGTACCAGCCTGCTTGTGGCTGTACTCTTCTTGGAGGGCGATTCGAATCGCCTC
CTCCATAGTTGTCGCTTGCACCCGGAATAGCTGAGTGCGAGCAGGACCGACCTTCAGGCCGTCCATGAAGACTGTTGTCTTAACGGCTTCAGGCAGAGGA
TTCCCTGCCAGAGATGCCACCAACGTGCGCATCTCTTGCGCGTACTCCTGCAGCTCACGTTTACCTTGCTTACACGCGAGAAAGCGTGAGCGCTGGCGGA
ACTTGTTGTTCGCCGGTAAGAACGCGGCTCGAAGCTGCTCACACAGCTGAGCCCAGGATGCAAAGCATCCAGGAGATGTCGTCTCCCTGGTGTATGCCCA
GTGCTTGGCACGTCCACCAAGGTTGGACAGGGCAAACGCCACTCGAACTGGCTCGTCCGAGATGAGACCCGCCTTCATGGCGATCTCCACCTCACGGACC
CAGAAGTGAAGGTTCTCTCCTTCCTTCCCCTCAAACGCGGGGACCTTCAGCCACACCGGCTTAGGCCTAGTTGCCTGGGGAGCGGCCATCGTGGCCTCCA
AGCTCCCGCGGACGTGAGCGATGAGACCACGCTCGTAGGTCTCAAACGCGGTCACGCGCTCTTGTTGCTCGGCAGGCGTCGCCGCCGCCAAGCTGCGAAG
GACATCTTGTCCAAAGATGCCTCCCATCTTCCGAACGGACTCGTACTGTGAGTCGTTCAAGCGAGGAAACTCGCTTCGGTCCATCGTGGCTCAAACGTTG
GGCGCACAGAGGATTCAGGTAGCTCAATCTACCCGCGATGGTGTTGGATTGACTACTAGTGCTACCAAGTGTGACGGGGTCACACAGCACCTTGCACAGA
GGAAGTGCTTAAGGGTATTAACTACCCGAGTGAACGTAAGTCCACGTGTTCCCGGCCTCAGTGGGAACGGTTTGCTACTTAGAGGAGTAGATTTAAGACT
GATGTATTTATAAGTAAGATAAGCTTGGGTCTCATACAAACTAGAGGTTACCTATAGTGGAGCTAAGTAGTCATGCACTGACTGGTTCCGAGAGCACCTG
GTACCGTGTACCAGGTGTCCACAAGAGTGACGGGTCACTCTTTATGTAACATGGGGCACACTGGATTGTACCCCGTTACACAGCCGTACAAGTACCAAGT
CGGCTCGTTCAGCGACGTGTGCTTCCGTTTGCTTCCACAAATCGACGTGATGTGGTGGCGGGGATTCCGTTGTGGGCGGCCACAAGCGTCCAGTCACCGC
CGACACGGAGGCAGTCGAGGACACGAGCTCTGGCAAATGCGAGGTGCGGGGCTCTGGGCATCTTGGGGTAGGTAGAGGCTTGGCTTGGTTGAGGGCTTGG
TAAAAGATTGATAAGAGAGAGCGAGGAATGGCAATGAAGTGCTCGCGCACACGCTCAGGAGGGTTGATCCGCTTTGAACTGCGAATAAACCACTTTGAAG
TACGGAGTGCGTTTACTCGACATATTTGTGAAGTGACATAAACTCTAATGTAAAAATTGAGAATAATTTTTAAAAAGGTTTAGTTACTTCACCACTTTGA
AGTGGAGTAGCACCATCTTGACCTCTTGACCTGGCAAAGGTGTAGTTGCCGTCTTAGATCCGTTTTTGTATCTGTAGTTGCACGGCGGAGCATGAGCACC
TGTGCCTTGCTTAGTTTCTCTAGCCAGCCTCTCACAACTCAAATGAACGAGGCGGAGCGCTGCGCAAAAAAAGAAACAAATGGTTATCTATTTCCGAGCG
GAGGTAGTAGTACAGTAGAGCAAAAATAAAACGAGAATCATAGCACGCTGGCAAATTGACCGACAGAAGAATACAATTTGGAGGAGCGCACAATCATTCA
CTCGATCCTAGACGCAGTTAACAACCGTACAGCTACAGTCGTGTGGGCTTGACCGTGATACTCTGCTGCAAAGTGTAGGTGTGGCCGGCCGGAAGAGGTT
GCTTGACGCTGACCCGACCAGGTTCGACGCAAACCATGTTGATGTACTCCTCGTCACCGAAGTCCTCCAGCTTCTTGGCACGCTCGGCACCGGGGTTCCA
CACGACGGCGTCGGTTTTGGTCTTGATCGCCTTCTGACCTTTCTTACCAGTGATGAAGCCCTTCTTCTGGACGGTCACAGAGCGGTCTTTGGTGCTGACA
CCTTTGATGGTCGCGACGATTTTGTCCGGGGCGTCCAGGTACGTGTTTCCGGTCTGCGCCGTGGAGTTGGTGAATGTGACGGACTGGCGAGTCTCC