Description :
From Genome Similarity Track
Location :
contig_50:425134- 428263
Transcript NameFunction/comments
g8478.t1P-type ATPase (P-ATPase) Superfamily

Sequence
3129 bases(100 bases per row)
GACTACCGCGTGGTACCGCTGCCATCCTCACGTAGACCGCCCGCAGCCGACGCACCGCCCGAGTTTTGCTCCAACGTGGTGATCACGTCCAAGTACACGA
CGTGGAACTTCCTGCCGCTCTTCATGCTCGAGAGCTTCCGCAAACTGGCCAACGCCTATTTTCTGCTGGTCTCCGTGCTACAGTGTATCCCCAGTATCAG
TAACACCAACGGCCTGCCCTCCAACCTGCCCGTGCTCGTGTTCATCCTGGCCGTGGACGGCGTGTTGGCCGTGATCGAGGACCGCCGCCGCCACCTCGCG
GACAAGGAGGCCAACTCGGCCCAGTGCCACGTGCTCAAGGAAACGTTCACTGGCCCAAGCGACGCGCTGCACCGCGCGGGCGGCGTGGACGACCCGGACA
TCGCGCTCATGCACTGGGCCGCGCTCACCGTCGGGTCTGTCGTCAAGCTACACAACCGGGAGACGGCCCCCGCCGACCTGCTCATCCTCGCCGTCTCAGA
GCCCAACCCGAGCGAACCCGCGGGCATTTGCTACGTCGAGACCAAGAGTCTGGACGGAGAGACGAACCTCAAGCTGCGCCACGCGTGCGACCCCACGCTG
CACGTGCAATCGGCGGCGCAAGTCGCGGCGCTCGCCGGCCAGCTGCGCTGTGAGAACCCCAACAAGGCCATTGGCCGCTTCGACGGCACGCTGTCCGTCT
CGGAAGGCACCAAGGTCTCAGAGGCGCACCCGCAGCCCATCGCCATCAAGAACGTGCTGCTGCGCGGCTGCCAGCTACGCAACACGGACTGGATCTACGG
CCTCGTGGTGAACACGGGACCCGACACGAAGATCATGCAGAGCGCGGCGGCCACGCGCCCCAAGTGGAGCTCCATCAACGAGACGGTCAACAAGATGATC
ATCTGGCTGTTCCTGCTGCTGTGCTTCTTGTGCATCATCGCCACGACCGTGCAGGTCATCTGGCTCAACAGCAACATCGACGATAGCTGGTACCTCAGCT
GGTCGCCCAGCATCTCGAGCCAGTGGTTTGTCGGCTTCGGCTACTACTTCTTGCTCATGTACCAGATGATCCCCGTGTCGCTGTACGTGACCATCTCGAT
GGTGATGTTTATCCAGGCCATCTTCATGACCTGGGACCTGGACATGTACTACGAGGAGGCGGACGTGCGCATGATTGTGCGCTCCATGGGACTGAACGAG
GAGCTGGGCCAGATCTCTTATGTGTTCAGCGACAAGACGGGCACGCTCACTTGTAACGTGATGGAGTTCCGCAAGTGCTCCATCAACGGCGTGTCGTACG
GCACAGGTATGACGGAAATTGGACGTGCTGCCTTGCGTCGTAAGGGCGTCGCTGTGCCAACGGAAGCGGAGCCGGACCAGGCGTCGCGTCGCACCAAGAT
TCCGTACGTCAATTTCGAGGACGCGCGGCTGTTTAACGCGTTGGAGCGTCCTATCAGCGACGATACGCCGAACCGTGAGGCCGAGTTTTTCCTCCACCTG
AGTTTGTGCCAGACAGTTATCCCGGAGGCCGTGGAAGGCACCTCCGAGGTGCGCTTCTCGGCCTCATCGCCGGATGAACAGGCGCTCGTGTCAGGCGCAA
AGTTCTTCGGCTTCAGCTTCGAATCCCGCGGTCTGGGTGTGGCTCGTGTGCGCGTGAAGAGTCCGGAATTGATCCGACGCTACGCAAATGGCGTCACCGG
CTCAAATGTGCTGCTGGAGTTCCAGATCCTGGACGTTCTGGAGTTCACGAGTGACCGCAAGCGTATGTCGGTCGTTGTGCAGTATCCTAACGGAGAATAC
TGGGTACTGACGAAGGGTGCGGACAATGTGATCTACCCCATGCTGGCCAAGGCTAAGAGTGACCCGGAGATGCTGAAGGAGACAATGCGTCATCTGGAGA
CTTTTGGTGACGACGGTCTGCGTACGCTTACGATCGCGCAGCGTCGCGTGGACGAAAAGGAGTACCTAAACTGGAGCGCGCGCTTCAAGGAGGCAAACTC
GTCTCTGGAAGAGATTGACAAGCGCAAGAACGGCCAGCCGAACGAGATCGACAAGCTGATGACAGAGATCGAGCATGACTTGGAGCTGCTTGGTGCTACG
GCTATCGAAGACAAGCTGCAGAACAATGTGCCCAGCTGCATTGCCAACCTTATGCGCGCTGGAATGCGAGTCTGGATGCTTACGGGTGACAAGCAGGAAA
CTGCGATTAACATTTCTTACGCGTGCCAGCTCATGGATAACGACATGCAGCAGTTTGTCTTCAACTGCGAGTTGTACCCGACCAAGGACGCAATCTTCAC
TCACCTTTCGGAGGCGAACTCACAGGTGCAGCGGGGTGGCGGTCGCCACGCTGTAGTGATTGATGGCGAATGTTTGGAATTGACGCTGGCAGATGAGCGG
TGTCAACACGAGTTTTTATCGCTGGCTATGGCTTGCGAGGCTGTGGTGTGCTGCCGAGTGTCGCCCAGCCAGAAGGCTGAGGTGGTGACGTTAGTACGAA
CTACAAACAAGAAGGTGCGAACGTTGGCGATCGGCGACGGTGCCAACGATGTTGCCATGATTCAGCGCGCGCATGTTGGTGTGGGTATCTCAGGCCAGGA
AGGTATGCAGGCTGTGAACTCTAGTGACTACGCTATCGGTCAGTTTTACTTCCTGGAGAAGCTGCTGCTGCACCACGGCCGTCTGAATTACAAGCGCATG
GCCATCTGGCCGGATACATGTTCTACAAAAATATTGTGATGGTGCTGGCGCAGTATTTCTACATGTTCTGCACGGGGTCGTCGGGCCAGAAGTTCTACGG
CGAGTTGGGTTTCCAGCTGTACAACATCTGCTACACCTCGCTGCCTATTATCGTGCTGGGCGTGTTCGACTACGACGTGCCCTTTGAAGTGAGCAGACTT
TTCCCGGAGCTGTACCTGGTTGGCCCGCGCATGGAGCTCTTCAACAACTACACGTTCTTCAAGTGGATCTGCAGTGCCGTGTACGAATCCGCTGTCATCT
TTGTGTTCGTCGTGTATGCGTTCAACGAGAACTTCTCCAATGCGGGCAGCGCACCTATGGTGCAGTACGGCTTGCTCGCGTTCACAATGGTGGTGCTGGT
GGCCAACATCAAGCTGTGTATGCTGCAAA