Description :
From Genome Similarity Track
Location :
Scaffold_230:42510- 46616
Sequence
4106 bases(100 bases per row)
CATATCAAGACCCTGCTCAGGTGAGCGCGGAGGCGTTGGCGCCAACGGTGGCTGGGCCACGGACAGCTGCAGGGCAGCAGGTGGTAAAGCCACGAGAGGC
TGAACGACAGCATGTGGCAGAGTCACAGGTCGCGGGGCGAAGTGCTCGAGATGCAGGAGCAAGACAAGCTGAACGTTCAGCCGGGCGACTGGACGCCCAA
GGGCCGAGACCTGGTTGTGAGTCAACAGTGGTGGCTCTAACCTATCCACAAGGTGGAACATCTCTTCGAGATCGACCGATGGGCGGTGACCGTGAACGTT
CGCGTCGTGGACGCCGGCTTCGTATGGACGCAGACATCGTTCCGGCAAGTTCTGACTCTCCCCGCGAGAGCCCAGCTGAGGCAAGGCCTCCTCCTGCTCT
GCTCGATGAGCATGGTGAGCTATACTTTCACGTGGAATGCCTTGTGGCGTGGCGTAGACGCCAGGGTCGTACCCAGTACTTATTGAAGTGGAGGAATTAC
CCTTACTCACAGAACTCATGGGAGTTTGAGGTTATCCTCCGGCAAGATTGTCCTGACTTCGTTGACGCTTACGACCGGGCACATCATGTGCCGAAGCGCC
ACCATGGCGTGCGACAGCGTCGCCAGGCGCTGGGCGCCTCCCACTAGAGTGGGGAGCGATCAGGTCAGTAGCTGAGCTCAGGCTCTGACCAGTGGCTGCA
GCAGCCAGCTCGTACGTATGAGCGGTGCTCGTAGCGGGAGCAGGAGGTGGAGAAGCCTCGTATTGTTAGGGACATGGTCCCGAAGGAAGCAGGTGCTTCG
TGTTGTGCTGAACAAGGTTCAGGCACAAGCGTCTCGATAGACGCATAGTTGTTTTGAAACAACTTGCTCGATGAGCATGATCCAAATGTGGATGCGCTGT
AACAGTGAAAGTGGTGTCCCGGACGGGGATCGAACCACTGGGCTTTGGCTTGACAGGCTGGAGCTCTACCATTGAGCTATAAGGGCGATGCCCGTACGTC
AGTCCGAGAACGGACTACTCATGGTATGAGAGGGCTGCGCCCGGGTGGATTTGAACCACCGACCTGTGGCTTCCAAAGCCAGCGCTTGACCACTAAGCTG
AAAGGGCGTTGCCCTTAAGCTTGCCCATTCAAGGACAACAGTTCATGGAACGAGAGGGCTGTGCCGTGGTGGGTTCGAATCCCCGATCTGTGGCTTCCAA
AGCCAACGCTCGACCACTGAGCTAAAAGCGGATTGCTCTTAAGCTTGTCCAAGCGTGGACAATCGTTCATGGAGCGACAGGGCTGTGCCCTGGTGGGTTC
GAACCACCGACCTGTGGCTCTCAAAGCCAACGCTCAACCATTGAGAAAAAAGGTGTTGCCCTTAAGCTTTTCCAAGCGTGAACAATCGTTCATGGAACGA
GAGGGCTGTGCCCTAGTGGGTTCGAACCACCGACCTGTGGCTTGTGAAGCGAGTGTTCAGCCGCTGAGCTGTTGTCGACGACTCGAATGAGTCAAGATCA
TTGCTCTAAGCGGTTTGCAGCTCTTGGAGTAGGCGCGGAGCGCGAGCGTAGGTCTGAGACCGCTTGAGAGCAAGATGCGCGCTGCGCTTGGAGCATTGGG
CCGACGACGAGAAGTTGGGCATCAACGATGCGTAGGCGTTTGTGAGCTCACGGAGCTGTACAACGCTGGTGTGAGGTGTAGTAACCTCCGCCGTCTTAAC
AAGACGTGACCTCGCTGAGGAGAGTTTCGAGAACGGAATGCTCTCATCTTAGTGGGGGAGAGTGTAACGGGGTTACATGGTGTGGAACACACAGGGGTAC
GAAGTACCCGGAGAGGTAACTAACTCTCAGTACATAAGTTGGAGAGTTAACAAGGTCTCTTAGTACGTTGGCCGAAAGCCACACGTTATGCATTTGATTA
GGTTTAACTATGCTAGATAGTTAAACAGATACATTTACCCCTAGACGGCTTGGCCGCAATAATAGTAAATAAAACACTTCTGGTTTTTAAGCATAAAAAT
TAAGGTGTTAACTTTGAGCCCTGGTCTTGGGCTGTAAGTGTCCTTTGGATAAGGAACTTAGTATTAGTGACTCTTTGAGTCGAACGTCTTCCTCTGACGC
TAAAGCTACGGCAGCCCCGCTGCACTTCACACTCGAGGGCGCCTCCTAGCCCCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAA
GTCATGCGTCGGGGCTCGGACGACGTGTTGGACCCATCTTCCGCCGCTGATTCGTAGTTAGAGGATGCAGCTCGGCTGATCCTCGGCTACGATACTGGAT
CCTTAGTGTGCGACCTTTCTCCGGTGATGGACTTGACTCTGGTAAAGAGGTCCCGCGTCGCCGATACTATAAGATCCAAGTCTAGCTCGAAGATATCCTC
TGCATCGAACGCACCAGCTACGACGCCTGAATCCGTAAGCAAACGTAATAGATCCTTGACTGCCACCACCTCGTTCGCCGTTTTCGTTGGTGCTCTCACC
GGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGCATCCGCATGACAGGAACTTGATGCAGAAACGCGCGTAGAGCTTGGTGGCGATATACAAACCCGA
GATACTTGTCGAACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGGGCTTGCATTTGCTTCCGCGTAGTCTTATTCGAGTTGGTCTTCTT
TCTCGTTTCTTCGACTAGCGGGGCTGGGTTTAGGTACGGTGCTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCTTTCACTTTCCCTTGCTTT
GTTAGTGGATCTTGACTTGCGTCGTCAAGATCCGAAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAAATTTATCTTCTAGATCTTGATCCGGATCCA
CCTCTCTTCCGTCGACAGAGTTCCTCCCGGGACTCTATCGATCCGCGGATCTTGTTTCATCATGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTC
TTCCCCTGGCTCAATCGTCACTTCAACCGCTGAGCTCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTT
CCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGAGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGCGTAGCGGGA
TCAGCAAAATCTGCGAGATTGCCAGATCCAGCTTACCAACTGCACCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTT
CCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGCGTCTTGGCGAGACGTGGGG
ATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTTCGTGGATTGCTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTG
GATCTGGCGTAGGGTTGCCTTACGGGTGTGTTCCCTTGCCTTTGTAGTTCCTTTGCGTCGTACTTGCCGCCTCATGTGACGGGATCTTGAGAGTTGAGAA
CCTCTAGGGTGTAACCGACCAAGTAGTAAATTCGGTTAATCTGTCGGATCTGCACAAGTAAAGGAAAAGCTCACTAGGTTGTAGGATCTGGCCAATGTAT
TACCCAGTTATCACTACTAACACTAGATTCGCAATTCCCTCCCCTTAATGCTAGCTCGTACGGCCAAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNN