Description :
From Genome Similarity Track
Location :
Scaffold_434:42508- 44897
Sequence
2389 bases(100 bases per row)
TATCCCTCCCCCATCAAGCCCTGAGCCACTGCGTGGCGGCGTCAGTGGGACGCGAGGGTTAACCAAGCCGTTCACATAGAACGGAGTGTAGCCTGTCGAG
GCGTGCACTGCATTATTTAATGCGAACTCAACGAGTGGGAGCATCTGGCTCCAGCGTTTTGGCGCCTCAGCGCATACGCTTCGTAGGGTATCCTCCACAA
CGCGATTCACGCGTTCGGTTTGACCATCGGTCTGCGGATGGTCCGCTGTGGACATGTCCAAACGAGTGCCGAGCACTCTGAAGAGGGACGTCCATAACTT
CGCGGTGAAGCGCGGGTCTCGATCGGAGACAATTGCCTCAGGCAAGCCATGTTGGCGAAAGACTCGGTCTAAAAACAGCAAAGCTGTACCTTCACCATCA
ATGGTGTCCGGCACTGCCGCTAAATGAGCCATCTTGCTCAATCGGTCTACAAAGACCACTATACCTGTGTTTCCCGCCTTATCCTTGGGAAGGCCAAACA
CAAAGTCCATACTCATGGACTGCCAGCATCCCTTGGGGACAGGCAAAGTCGCCAACGGCGCTGCCGTGCTCGGCGCGGACTTTGTCCGTTGACACGTCTC
ACACGTGCGTACATAGGTGCCGACCCACTTATACATCTTGGGCCACCAGTACATCGAGCTCACCGAGCCGTAGGTCTTCTCCCGACCTAAGTGCCTGCCG
ACGGGCGTATCATGAACCTCATAGAGGATTCGATACTTGAGATCCTCATCATGAGGAACGACTACACGAGGGTTATCCTCAGCGTCGGTGCTGTAGTACA
GCAGGCCGCCATCGAGTGAGTATCGATGCAGCCTCGCGCGTAAGCGCCCAGACAATTCCTTGTCAGATTCCTTAAACTCTTCGCTCCCAAGAGCCCGTAG
CAGCGCTACGCACATGTCGTCTTGTGCATACGCTCCGCGTATCAAGTCAGGCACTGACGACGTCACTGTCGTGACATGAGCTAGCTCGTAGTCCGGCCTG
CGCGAGAGTGCATTGCCCACTACATTAAGCCGCCCCGGCTTTGTACTTCACCTCGAAGTTATACTCGGCAAAGAAGGAAAGCCATCTTGCCATTCTCTGA
GAGAGATGAGGCGACTGTGTCGCAGTGCGTAACGACGCATATCCAGTAAAGATCACAAAAAGGCTTAGAGCCTAGCAGGTGTACCCTGAATTTGACTAGA
GCATACTTCATTGCAAGTAGCTCTTTGTCATGAGCTGGATAGTTCTTCTCTGCAGCTTTGAGCTGGCGAGACTCAAACGCGATCACGCGTTCACGCCCTT
CGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCAAAATCGGAGGCGTCACAGACGACGCTAAACGGACTATCCGGGTCCGGTAGCGCAAGGATCGGAGC
CTGGAGGAGACTCTCCTTCACAGCCTCAAAGGATCCGTCGTGCTCGACGTTCCAGCACCATGGTGCGTCCTTCTTAAGGAGATCTGATAATGGCCGAGCC
ATCTCCGCGTAGTTCGCACTGTACTTGTGCAAGTAATTGGCTAAGCCTAGCCACTTGCGTAAGTCTTTTTGGTTCTTGGGAACCGGCCAGTCCACGATGG
CCTTGACTTTGGCAGGATCTGCCCGTAAGCCACGCTTCCCAATGAAGCACCCGAGGAAAGGTATCTCCTCCGCGCCAAAGACGCACTTGTCCAAGTTGGC
ATACAACTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAGTGGTCAATGTGGTTATCCACGTCTGACTTTCCGTGCTCGGCACGACTATGGACGAAT
ATATCGTCAAAGTTCGTTTGAGCGTACGCCCGGTGGGGCCTGAACAACTGCGTCACAAGACGATTGAACGTTGCTGGTGCGTTCGACAGCCCCTGGGGCA
TCACCAGCCACTCCCAGAGCATACCGCTCGGAGTACTCACCGCTGTCAGCGGAATGTCGCTCGCTCTCATGAGCAATTGGTAGTAGCCATCGACCAAGTC
GAGCGCGCTGTACAACGTACAGCCTACCATGTTGTTCTGCAGAACATCCTTGCGAGGAATCGGCGTTTGCGCCGGGATAGTGGCCGCATTCAGCTTGTTA
AAAGCATGAACAATGCGCCACTTGCCGTTCGGCTTTCTGACACAGAACGTGGGTGTCGAGTGCGGAGACTTACTCTCACGCACCATCCCTGCCTCGTGCT
TCGCACGGAAGAATGCGTCAATGACGTCACACTGCTCTCTCGGCAAAGGCCATTGCCTTGTTACGCAGTATTTGGTTCCAGGAACCAGGTCAATCTCATG
ACACACGCCTCGATCCGGAGGCAGGCCCGTCGGTGGGTCTTTTGAGACAACGTCTCCATACTCCTTCACCACCGGGTAGAAGGGATCCG