Description :
From Genome Similarity Track
Location :
Scaffold_385:425- 4941
Sequence
4516 bases(100 bases per row)
CAGATTTGATGTCTATTGTGGCAAGCGGCAAACcgaccgagctgctgctgcttccgacACCAAGTCTGATCCAGCGGCTGTCATTCGCAATTTGCTAGAG
GTGTTTGGTCCCTCAGGATCAAATGAGATGCGTCTTGTTGTCACCGATCGATTCTACTCCTCTCCTACGCTCTcaatgcagctgctgacgcaCGGCTTCT
ACAGTATCGGCACGGTGATGACAAATCAGCGAGGATTGTGCATGCAAATATATCATCGTGAAGAAGCAAAAACGGCCTGCTAGTGTCTACCGGGGTACAT
GCACCGTAGTTGAAAACAAGTTGGTGCCTAGCATCAAGGCAGTGTGATGGTTGGACAATAGACCGGTCCACCTTCTCGCAGTTGGAGGAAGTGTTGAGCA
AGACCGAGTCGTGCGTCATGAGAAAAGTGGCGATCAGGCTGGAGTGGCATGCCCAAGCATTCTCCAGGGCTATCAGACCTTCGTAGGCGGCGTTGATGTC
CATGATCAacttctcctccagcggTATGTCTTGCAAATTTATAAGGTCTGTTCTTATCTTGTATCATTCATGTTACATACAGGTACTCGCTTCAACCAGC
GCTGAAATACAAGAAATACTACAAGTCGTTGTTCCTGGGGTTCATCGACCTTGCCAGTGTGAACGCGTTCACTGTCTACAATAGTCGACAACTTGTTGAC
TGGAAGAGCAAGGTCACACACGTGCAGTTCCTCAAGTAGTTACACATGGAGTTAGTACAGCTGCAGGAGTGTGCTTGGGATGCTCTACGCAGCAGGCAGA
GTACACAGATGAAATCACAAAGTGTAGCGATGtagcgacgacagcgtgcCTGTAAAGTGTGCTCGATCTTGAAGGGGACCGGCGAGGCGAAGGGCGTCGA
GACAACGTTCTACTGCGGCACATGCAAGCTACACAGCATCTCCAACAAAACTACAGCCGCTCGCGTATACCTGTGCAACAAGGTCAAGCACACAAGCAAC
GGTGAATCGGTTTCTTGTTTTGAGATCTGGCACAAGCATTGGGGGAACGGTAACATTGCCACCGTCACAGCAGAAAAAGAAGATTCGAGCGGGCACGACG
GCTGCCCTCGCGGATGATGAGACCCAGTCTGCAAGTGGCGACAACAGTGATAATGATGCCAAGCACCAGCCGAAGTGCCGTCGACACGTGGAGACAACGG
GTTGAGCATCTATTTGTGTCGACCAGAATACCTAACTTTGAGTATAGTTCATTTTGCTTTGGTAGCAGCTGTTGTTGATGTCTATATTTCGACAAATTTC
TCAACGAAGACGCGCTGCTTTATCACGATACCGATCTGTTTATGCACTACAGATTACACGTTACACGCCTGTCTTGTATTTCTCGGACTAGATACCATGT
ATAATACATGGTAGATATTTTTCACCATCTTAGGTGTTGGGATTTGGTGGAGCTATCCATGTACATGATACATATATATACTACTTTCAATATCTTTGCC
CTTCCCCTTATATACAAGTTGATTTGATTAGGGCTGAGGGAAATGGGTGCGCTGGAAACCCCTCGTATTGAAGGGGTTAAATACCTCATTGCATGCTCCA
CTCGGAGCAGTTTGAACTAGTGAGCTCGGCAGTGCAGGCTTTTCCTCACGATTTTGGGTTTGAAAACATTTGCGACCAAGGGTCTATAACTACATACGGA
GAAAGATCACCAGTCGGAATGATGGAGCTTCAGACGTTGATGACGGTTGTTTCGAGGCCGCCTTCGACCACAATTCATCGCCTAACGGGAGCAACCAACC
ATGCCAGCGCAGCGTCCTGTAGACAGGAGTGCTAGGTTTGACATATCTTCGTTGTTGTCCCCCAGGACACCTGCTTCAATACAACCAGGTCATTTCGAGT
CACCTACACGCGACAATTATCCGCGCCAAACAACTCATTATTCAACGGTAGATGGACGCCTGCCGCTTGCATCGCCTGCCTTAGGTATTCACGACTTGCT
ACGGTCGATAAGTTAACATCGACTGCTCTTTCGTCCTCATCAAGATTATTGTATTCATGTTTGTTACAATTTGGACCTCACACTTCCTAGGCTCGTGAGA
TATAGTTCTGACGACGATCGATCATGTCCGTTGGTGTTGCCAAACGGTATCATCAGCATTGAGCCACAAAGTCAGCGCTGATGTTTGCGATGGTGGTGTA
AATGTGATGGATATTGTTGCCCACTTTAACTATGCTAGCAATTGTCAACGCTTTTATAAGATGTTGGTGCACTTGTAGTTACAGTGCATTGTCTCGCTTT
CCGCATGCTGAGAGCGAGTCGATGCAGTTGTGCATGTGTGGCGTGGCGCACTGAGTTAGGCTCTCGTGGcaaccaacagcagcgtcgaaaaaaaaacagc
GCTCACCGAAGGAAGCTTGCTGAGTCTGGAGCAGAATGACCAAATGGTGAATGACGACAAGAGTAGATGAACCAGTCAAGAAGCAAGTGCACACGACAGA
TGCGATGAGTGAAGGAATCCTCGCTtacttgctgctcgtggcctCATGAGTAAGAGCAGATGTGCGGAGCCGCATGAGGAAAGACTGCATACCGCCTAAT
AGTTTGCGTACCGTTAGACCGCTCCCACACTAGACTTATCCGGCAGGCTTCCGTGGCGATCGAGACGGCTATCTGTGTCCCAAGCTTCCTATccacctgg
agctggaggaagtACTAGGCTGTAGAAGCCTGATTTTTGACGTCAAATGCCGAAACAGACCACCCGCGGTCATCGACGTGGTAACCACAGCCGtctcagc
agcagtcgatTTTGTTAATTCGTTATAGGAGCTCGCCCGCTCGATTCTCATAAGCTGCTCGTTGTCCGTCAACATTCCTTCTACGTCCGCTAAGTTCTAT
ATTGCTCGTGACATTTGTTAGAAGCAATACGGTGCTCGAACGCGTGCAAACGAATAATGGGCCGCCGCCTGTACCCATCGTCAACTCCAGTCGACGCGCA
TTGCGCACCGACAGGTCTTGCAGCCCAGGCTGAGCGGTCGTTTTCTCCTCGTGCTTGCCTTCGTTGTTGTGTCGGATCTGTAGCTACTGCAGCTGGCACG
ACCGCTTTCTGATAAAAGTCGATACATTGTGTTTCAGTTGACGATAAACGTCTCTCCTGATGTCTGTCTATCGTCTTCAATGCTTTCGTGTCCTGTTATT
CTCTTTCACTGTAGAAGTCGTTACAATATCTTTAAATCCGCTTCAGTTCACCCAATAAACATCGCAGTGTCAGGTGTGTATTGGTGCTTGGTACATATTT
AGTCGACGGTCGATTAAACCTACACTGAGAGCCCTAACCAGTTCAAACGTTAGCCGGTTCCGCTTTCGGGGAGTGTGCTCACCAATTCCTCTCATTACAG
ATTCATCAAAGAACGCGTACAAGTCATGGGGAAGAAGCGAATTTATACGATGATCGAGAGAGTGAGAATCCTCAAGGAGTGGCAGAAAAATCTTCAATGG
AAGCATtcgaaggcggcgatggGACTGGGCGTCAAAAAGGGGACACTACTTGGTAGGAGAAAACAACTCTCCGATGAAAAGCTTTCATATATCAAAGAAC
CAACATGTGTGGACGGGAGATTTAGAAAGTCGAGTTCAGGGCCACCGAGAAAGGTTCAACCATACGAAGATCGCATGCTTCAATTCTACGAAACCTCTGG
GTGGACGGTAACAAGGCAACGCAGACTGAGATGCTATAGTACTGCAACCAAATGTGTGAGTTTGCGGCGCGGAACGACAATTCTAGTCGAGTTGGGTGTT
GCGTTTCATGCGTCATTATTGGCCAATTGTTGTTCCGGagatcgccgtcgtcgcacctggagctgccaaggacggtggcgctgccgaACAGGCTAGCACA
ATGATAGATGTCGACTCCGACGTCGTTGGGTAACAAGTGGTAGACTCTGAACCCTCCGAGGCAAGCGTCATGGAGATAGATGACGTCGAGCATTCGGATG
TCGCGCCCGAAGACCTCAGTGCACCGTGCACGAGACCCCCTGAAACCAAATCACCACGACCGAGGACCctgacgaagcagcaggcgagcTCGGGTCCTCT
GAGGACTATGAGTGCCCCAGAGGATATTGAACATGAAGGCGCCTAGATAGAGGTCTCTCTATACGCATGCGGGTGGGGATCCCACAGCGCCGGGGTGAGG
CAGCTACCTTCCATTCGTGAGCGGGGAGACGGTCGTGATCCAGGCTGGTGTACAACCGGACTTCACCTTTTTAGTAGATTGGCTGTTCCAAAGGCCGATC
TACAGCTCTTCCTCGGTCCTTCGACAattccagctcttcaagtTCTAAAACAAATACAAAACAGGCGCGGAATGGTCATGGACGCCGATAATATTAAACG
GATCCTTTCTAGCCCGACAATAACCCGGTACCAGCGGCGCGTTACTGCCCTTCAAGCAAAGCAGGAACACCTGGGTGAAAAGGGCGTAGTTATTGAGGTA
GAAGACATTGGCACTA