Description :
From Genome Similarity Track
Location :
Scaffold_1515:425- 4294
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1515-fgenesh-gene-0.0Pyruvate dehydrogenase E1 component subunit alpha

Sequence
3869 bases(100 bases per row)
GCGCCGCCGCCAGCGGCGACGTCAAATTCGAGTTCGTGCAGCCGTTCAAGCTCCACAGTACGAAATGAATGCTCTTCTGAGGGAGGATGGTGATGGATGA
GGTGTGTGTATGTCCTAGATTCTTACTTTTCTGCTGTTGCTGTTGTGTGTATGTAGACCTTGAGGAAGGCCCGCAGAACTTTGGCTACGCGAACCGCGAC
GAGCTGCTGAGCTTCTACCGCCTCATGTACACGATGCGCCGCATGGAGATCACGTGCGACAACGAATACAAGGCGCGCACCATCCGTGGTTTTTGCCACT
TGTACGACGGCCAGGAGGCCGTCGCGACCGGCGTGGAAGCCGCGCTCGACCGCAAGGACTCGTGGATCACATCGTACCGCAACCACTGCACCATGCTTGC
GCGTGGCGGTACTGTGAAGCAGGTGCTCGGTGAGCTTTTCGGCACGGCATCCGGCGCGGTGAGCGGCAAGGGTGGCTCGATGCACTTCTACAACAAGAAG
GAGAACTTCTATGGCGGCCAGGGTATCGTCGGTGCCCAGGTACCAGTCGGCGTGGGTCTTGCTTTCGCGAGCAAGTACAACCACAAGGGCGAGGGCTTGA
TGCCGTGCTCGATCTCCATGTACGGTGACGGTGCCGCGAACCAGGGCCAGATCTGGGAAGCCGCGAACATGGCCGCGCTCTGGAAGCTGCCAGCGATCTT
CTGCATTGAGAACAACCACTACGGCATGGGCACGTCCGCGGAGCGCTCGTCGTCGAACACGGAGTACTACACCATGGGCAACAAGATCCCAGGTATCTGG
TGCGACGGCAACGACGTGCTCGCAGTGCGTGAGTGCACGCGCTTCCTGAAGAAGTGGTGCGGCGAGGGCAACGGCCCGATCTACGTCGAGATGAGCACGT
ACCGCTACCACGGCCACTCGATGTCGGACCCTGGTGTGACGTACCGCAACCGCGACGAGATCTCGCAGATGCGCGCGTCGCGCGACCCGATCGAGAGCGT
GAAGAAACGCTTGCTAGAGCACAACCTTGCGACCGCCGACGAGATCAAGGAGATCGAGAAGGAGGTGCGCGCCGAGGTGGTCAAGGCCACGAAGGAGGCC
AAGGCGTCCGGTCGCCCAGAGGAGGCCATCGCGTTCCAGGATGTGTACACGGACGGCAAGGGCGGCAACGAGTTCCCACCGTTCATCCGTTTCCCAGACT
ACACCAAGAGCCTGTACAACGGCAAGCGCAAATAAACGAGTAGCATAAGTAGGCTTCCGCCATCCGTATGCGGTGTGTAGTTGTCTTGGACTGACCAAGT
TTTCTGATACCAATCTAATACAACACGATTTTTTTACTCCACACGAAGAGCCCTGTATCCTTTGTGCTTGTGAGTGAGTGGAGCTCCTGGTACATTCGGT
CAACTTCAACTTAGTCAAAGAGCTCTATTTGAATGGATGGAAGTGAGCTGGAACCTGGTGGTCGACAACCTGATGTGCTTGATTGGAAATGGATATGCGA
GAAGATTGGTTGATGGATGGATGGATACACTTTATATTGATTCTCTCTCTCTCTCTCTCTCTCTGGGCTTATAGATTAATTTGCTTCTCTTCTCTTCGTT
CGCTTCTCCGTCTTCTTCGTCGACCAATACTGACACAGTAATAATACAGACACATTCATCATCTCTCCCAGAGGCTGCTGCTTTTCGTCGGCCTCCGTCT
TTCTCCTAATACTAACATACAATAGGCATTCGTCACAGCACAACAACTCAGCCATGCAACCATCTACCGATAGCTCGTGGTGACCTCGCCCATGGACGAC
AGTCCATTGTTGTTGCTGCGGTGGTTGTGGTGGCTGCGATGGCGTGTGGAGCGCACTTTCTCACGCTGCCCACCGCTCACACTCTGGTTGTTGTTGTGGC
GGCGCAAGCTTGCGTCCGTGATCTGGTTGTCGTTGTAGCTTACTTGCTCCATGGCGCGCGTGAGCACCACGACCTGCTGGTCCATCTCTTCACAGCTGTC
GTAGAGGGTGGCGCCGACGGTGGTCGACTGCACGATCGCACAGCGCGCCTTGCGGGGCTCGTACTGGCTGCTGCTGCTGTTGTTGTTGACCGGCACCATG
ACTTCGTGTTCGCGCTGGAGCGCGAGGATACGGTGGTGCGACAGCTTGCGCGCGTGCTGCGCGAGATTGTTGGCGTACGCAGCGTCGTCGATGATGTTCT
GCGAGCGCAGAATCGCGGCGTCCAGCTTGGCCTTCGTCTCCGAGCTCATCATTGGGAATGAGTAGCCATTGCCATTGCCAATGCTGTGGTTGTTCTGGGC
GATCTTGGACTCGAAAGCGTGGTACTTTCGGCCTCGGATGCCTTCTTCGATCAGCGGTTGTGTGGCTTGCAGCGGCGTCAAAAGGCTGTTGCTGCTGGTT
TCTGGATACTGTCGCCTGGATGAGCGCGTAGGCGACTGCGACGAAGTCGGACTGTTCGACGACGCTGACGCCTCCGAGTCGGTCTGCGCCGACGCCGAGA
AGTACTCAAACTGGCGCAGCGACTCTTCCGTGTCCGTGAGGTCGCCGTCCTCGGGCTCCTGGTCGCAACTCCCCATGCGCTGCTGGTGGTGGCGGAACGC
TTCAATGGAAATCGCCAGGTCCGCGGGGCTGCCGCGACGGCGCGACGTGAAGAAGTTGCCCTTGCGCATGACGAAGCCATCGCTCAGCGACCGCAGAGGA
AAACTGGCTTTTGGGATCTCGACGATCTCCGGACTCGACGAGAACGTCTTGTACTCGATCAAGCGATTGCGCACAGGCTCCAAGAGGTCGTCATACGAGC
GGCGCTTGCCGTTCGAGAAGCTCTGGGTACGCGCGATCTGGCCCGGTTTCCCAGGTGAGCACGGCGACCGGGTGTTCTGTGTGGAAGAGGACGAAGACGA
AGGCGCCGACTGCGGCGAGTCGGTCGCGTACCGCGACGTGCGGCGCACTTCCAGCACGCACGCCGTGCATACGCGCAGCTGGCGCTCGCCGTGCTCAGGC
ACTAGCGCGCAGCGGATTCGGCTGCAGCTGCTGCAGATCACTTCGCCGCACTTGAGGCAGTTGTAGCGGCGGCGGAGCACGCAAAAGTTACGCTCGCAGA
CCTTGCAGTAGTCCTGCTCGCACATGGGCATGACCTGCTGCGGGAGCACGATCGTCTCCTTCTTGGCGCGGAACGTCTCGATGTACTTGAGGATACCGTT
GATGCATTTCTCAACGTGGGACTGGACTGCCGAGTTCGCGGCCCACGCGGGTAGGTCGCCATTGTCAAAGTTGCACGTGTACGTCATGCGCAGCTCGCCC
GGTTTCTTCGTGGTATGGTACATGAAGCCCATGAGCGGCACGATGTCGCGCGTGTACTTGGACGACTCGGCGTATCTGGAGCTCTTGGGCACAGCGACGG
ACTCCATGATGCGGAATGCGATCTTCTGGCCCTGGTCGTCCTCGATCATGTCCACGTACTCGAGGATGGCGAAGTCTCGGTCTTTCGTGAACTTGCTCGA
GCTCTTGAACGCCGCCCACTTGAGCGCCACGTACCGGTGCGGGTTGAGTTCTGTCGGCTCGACGATGTTCTGGATCACGGCGCCTTCGATGAAGTCGGAC
GAGAGCAGCTCCATCATCTTGGTGTACGACTCGGTCGTGCTCGTGATCATGGACTCGGCCACGTCCTCGATCTCGCACGTGACCTTGCAGACCGCGTGCA
CGTTGCAAGGCACGTTGTTGCCCACGTCCGCACGGAAAAGCGAGATGCCATGCTTCTCGTGCACGAGGCACCACGGGATGCCACCAAGCAAATCCGTGGC
CTCCAGCAGCGACTCGGTCATGCTCTTGGCCACGCTCGTGAGTCTCTCCATCTCGCGCACGCTCATCTC