Description :
From Genome Similarity Track
Location :
contig_72:425- 4158
Transcript NameFunction/comments
g12034.t1hypothetical protein

Sequence
3733 bases(100 bases per row)
CATCTCCAGCTTGCATAGCCTGGAAACGGGCTCTTGCGCGCGCACCTTGGTTGAACTCGTATAGTAGAGCACCACAGTTAAGCCTCGACACAGGTAACCA
TTCCGTTTCATCGTAGCCCTTCCATTTCACAAGGTATTCGCGAGAGCGCCTTGATGTCCGAGTTCTCTTAGTCCAGCGTAAATCTAGGATTCGCTCGACT
TCATACTCGTCATTCTCTACGTCAGGTTCCCAGCTGTCTTCTGGTAGGAACGCTGCGTCAAAGTCGTCATCTTCCTTCACGTCAATTTCCACAGCGGGTC
GCTTTGGGAACAATGCTCTAGGCTTTAGTCGACTCACATGCACCCAGGGATTAACACGATATCCTGAGTTCTCAATCCTGAGTTTCACTCTGAAGTCGTC
GTGCATTTCCTGGATACGGAATGGACCATGCCACATGTGAGCTAGTTTCCGGCTGAGTCCGGGCTGCACCTTCGGTATATATAACCAGACAGCATCGCCC
ACAGCGAAGCCAGCTCTCAATCGTTCGGACAGTTCTTTCCACTTCCTGGTCTGCTCAGCAGAACGCATGCGTTTAGCCTTCTTTTGCAGGTCTCTGGCAC
AAGCCTGAGCGTAGCTGTAATCACGCTGCAACTTCCGACGCCAGTCATACGCAGTGCGTTCCTGGACGCTCGACGGCTTGGGTCCAAGCATAGCAGACAC
CGTACCGTGTGCGTCCCAGCCGTGCACCAGGAAGAAGGGGGTATCCAGTCTCGTTGCATCAAATGACGAATTGAGAGCGAACATCAGTCGCTCTGCATGA
TCATCCCAGTCACTCTGGTCGGCTTCCGCAACGTACGCGCGGATGCTTCGCACCACAGTCTGCACAGATCTCTCCTGCTGGCCGTTGGCTTGAGGGCGAT
ACGCCAGAGTGGCTCGCTGCTTGCTACCCAAGAGTTCCCGGAATCGCGTGAAGACCTCACTCATGAATCTTGGATCCTGGTCATGTCTTATCATAGAACT
CGCTCCGAACCTCCTGAATACGCATTCTTCATAGACTTCAGCGACATCTTGGGCCGTCGTAGAACTCATGGGTTTACACATCACGAACCCCGAAAACATG
TCCTGGAATAGGAGCAAAAAAGTGTTTCCGCGGTCCGACTTAGGCATGTGCGTCACGAAATCCATGGACACAACCTCGAACGGTCGTCTGGGCTCAATGT
TTCCAGGCGAAGGTCCAGGATTTGGAGGACGCCCCTTGCCGCTGGCGCAATCTACGCATTCCTTGACGAATTTCTCAACATCGGCATACATACCGGACCA
GTAGAATTCAGAACGAAGCTTCTCATACGTCCGCGTGATCCCTTGGTGTCCACCTTGGAAATCCTCATGTGCGTAGTGCAGCATATCTGAATGTAGACTC
CTTGGCACGACTAGTCTGAGTTCGTCGACCATGTCACGTGGGCGATCTCTGGTAGACCGACTCAGGCGGTAGATGACTTCCCGAGAGTCAAGCACGAAAT
CATCGGCGACTTTGGCAAGCTTCCTGGTTTGGGCGTGTGACATCTCTGTTACATCACCCTTCAGGAAATTCTTGAGTTGCATCAGGAAAGCGTCCTTGTC
TTGATGCAGCTTAATACGTCGCCATCGTTCCGCTTGGTACTCGATCGGGCCCATCACATCGCCTTGGTCTGGTTCATCCTGAGCTTGTGCACGAGTTACG
GCAACAAGCACCTTGGCGGCCAGTGGCAGAGGTGCGGACTCTGGTCCAGGGAGATTTGTAGAATCAGCATCCTGGCCATTGTCGTCCTGCACTCCCGCAT
CCAGGATTTGAGCGGGTTTCATCAGCTTCTCGTGGATCTTGGACACCAATTGCAAGTGTGTCAGCTCGTCCTCGTCCTCAACCTTCCAAGACTCGTCAAG
CAGTAGCGTCTTAGATGTCAAGTAGTCTGCCGCCTGGTTGAATTCACGCTTAACGTGCACCAGTCTGACGGACTTGAATCTTGGTCTCAGAGCTTCATAC
TCGGCTAGTTTCCTTTGTAGGTTTGGTTGGTGACAATTGATCAAGCCTTGTGCTTGTTGGATGATGATCCTGGAATCACCGACCACAACGATCTCCTGGA
CGTCATGTTCTAACACCATGTTCAATCCCTTGAGCAGCCCACTGTATTCAGCATCATTCACGGTCACATCTTCCAAAACAAATCCTTGTGCATCTAGGAC
CTTCCATCCAGGGAGGCGCCACAGAATGCATCCGCAACTGCCACGGCGTGTAGACGTCTTGGCGGCACCGTCGAAACTCAGGATGTGGCCTTCAAAGTCA
GCACCCAACATCTCCAGACTAATGGGAATTATTGGTGCGACTCGACCCTTAGCCGGGATCAAATTCTCCGCGACTTCGTCCAGGTGTTCTCTAGGTGTGA
TTCCTGCATCTAGGATGGCAGGTAGTCCGTCTTCATCACGTTGCACTCTGCGGATCTCCAGATTCCAGTGTGACAGGATTACGCCCCACTTGACGTTCTT
ACCGTCTGCCGACTTGGATGTCAGTAGCCACTTAAGCACAGAGTATCGGGTGTATACTACGATCTTTGGACTGTGTTCCACCAGATTCCTGAACACTTCT
AGGACTCGCATGATTGAAATCACTTCCTTCTCGGCGAGCTGGTATCTCAGCTCAGCGTCGTTCAGGACGCGCCCCGTGAAGCGAACCGGATGAATGACTC
CGTCGTACTCTTGGCCTAGTACCGCAGACGCTGCCCACTGATTAGCATGCGGGATGATCACAAATGGTCGTGTGCGGTCAGGATGCCGCAGTAGTGGAGT
CGATACAATCTTGCGCTTCAGGATCTCAAACGCTTCCTTGGCTCGCGACAAGTCTCGTCCAGCACGTATCTGTTCGTCCGTCAGCTCATATAGGACAGCG
GCGATCACGGGGAGGTCTTCGATAAACTTATTATAGTAATTCAGACTTCCCATGAAAGACTGCACTCCCTTGAGTGTCTTCGGGAACGGCAAATCCTGGA
CTCCCTTCGCAATCTTTGGCTTCGCCCGGATACCTTCAGCACTAATTTCATGCGAGAGGTACGGGATGGACAACTTGCCAAATTCGCTCTTGGGTAGACT
TACAGAGATATTCCAATAGCGTAACCGAAACAGTAAAGCGTTCAAGTCTTCACACAGGTGATCCCATGTTGGTGCACCATGAGCGATGTCGTCAATGTAC
GAGCTGCGCCCGAGCACAGGGCCCATCTGAGGTGGGGCTGGGATGTTACGCTGGAAGACTGTCATCTTATCCGTCAAGATCGAGAAATCCTCCTCAGTAC
TATCAGGACTCCTGGGTTCCAGAGGATCAAGTTTCAGGAAATCAAGTACGTCAGGGTCCACCTTTGCTTCTTCCTCAGAATCCAGGCGAACGAATCCCCA
CAGACAGTTGTTGATGACTGCTTGATAAATGAGTGGGGCGTTCTTTAGGCCGAACGGCATCCGGATCCATTGGAAATGCCCAAACGGACACACAAACGCA
GAGATCAGCTTGGCTCGCTCGGTCATTAGGACAGCCCAGAATCCACTTGCCATATCCAGACTCATAAACCACATGGCCGATTCAAAACCAATCAGCAAGT
CGTCAATGAGTGGCAGAGGGTAGTGCAGTAACTTGATAAACTCATTCACCACACGATAGTCGATGCACATCCTGATGTCAATCCCATTCTTCTTCAGAAC
GATCACAATCGGTGATGCCCACTGCGATTCAGA