Description :
From Genome Similarity Track
Location :
contig_72:425- 3173
Transcript NameFunction/comments
g11513.t1hypothetical protein

Sequence
2748 bases(100 bases per row)
TCATCTCCAGCTTGCATAGCCTGGAAACGGGCTCTTGCGCGCGCACCTTGGTTGAACTCGTATAGTAGAGCACCACAGTTAAGCCTCGACACAGGTAACC
ATTCCGTTTCATCGTAGCCCTTCCATTTCACAAGGTATTCGCGAGAGCGCCTTGATGTCCGAGTTCTCTTAGTCCAGCGTAAATCTAGGATTCGCTCGAC
TTCATACTCGTCATTCTCTACGTCAGGTTCCCAGCTGTCTTCTGGTAACAAGGCTGCGTCAAAATCGTCCTCTTCCTCCACGTCTATTTCCACAGCGGGT
CGCTTTGGGAACAATGCTCTAGGCTTTAGTCGACTCACATGCACCCAGGGATTAACACGATATCCTGAGTTCTCAATCCTGAGTTTCACTCTGAAGTCGT
CGTGCATTTCCTGGATACGGAATGGACCATGCCACATGTGAGCTAGTTTCCGGCTGAGTCCGGGCTGCACCTTCGGTATATATAACCAGACAGCATCGCC
CACAGCGAAGCCAGCTCTCAAACGTTCGGACAGTTCTTTCCATTTCCTGGTCTGCTCAGCAGAACGCATGCGTTTAGCCTTCTTTTGCAGGTCTCTGGCA
CAAGCCTGAGCGTAGCTGTAATCACGCTGCAACTTCCGACGCCAGTCATACGCAGTGCGTTCCTGGACGCTCGACGGCTTGGGTCCAAGCATAGCAGACA
CCGTACCGTGTGCGTCCCAGCCGTGCACCAGGAAGAAGGGGGTATCCAGTCTCGTTGCATCAAATGACGAATTGAGAGCGAACATCAGTCGCTCTGCATG
ATCATCCCAGTCACTCTGGTCGGCTTCCGCAACGTACGCGCGGATGCTTCGCACCACAGTCTGCACAGATCTCTCCTGCTGGCCGTTGGCTTGAGGGCGA
TACGCCAGAGTGGCTCGCTGCTTGCTACCCAAGAGTTCCCGGAATCGCGTGAAGACCTCACTCATGAATCTTGGATCCTGGTCATGTCTTATCATAGAAC
TCGCTCCGAACCTCCTGAATACGCATTCTTCATAGACTTCAGCGACATCTTGGGCCGTCGTAGAACTCATGGGTTTACACATCACGAACCCCGAAAACAT
GTCCTGGAATAGGAGCAAAAAAGTGTTTCCGCGGTCCGACTTAGGCATGTGCGTCACGAAATCCATGGACACAACCTCGAACGGTCGTCTGGGCTCAATG
TTTCCAGGCGAAGGTCCAGGATTTGGAGGACGCCCCTTGCCGCTGGCGCAATCTACGCATTCCTTGACGAATTTCTCAACATCGGCATACATACCGGACC
AGTAGAATTCAGAACGAAGCTTCTCATACGTCCGCGTGATCCCTTGGTGTCCACCTTGGAAATCCTCATGTGCGTAGTGCAGCATATCTGAATGTAGACT
CCTTGGCACGACTAGTCTGAGTTCGTCGACCATGTCACGTGGGCGATCTCTGGTAGACCGACTCAGGCGGTAGATGACTTCCCGAGAGTCAAGCACGAAA
TCATCGGCGACTTTGGCAAGCTTCCTGGTTTGGGCGTGTGACATCTCTGTTACATCACCCTTCAGGAAATTCTTGAGTTGCATCAGGAAAGCGTCCTTGT
CTTGATGCAGCTTAATACGTCGCCATCGTTCCGCTTGGTACTCGATCGGGCCCATCACATCGCCTTGGTCTGGTTCATCCTGAGCTTGTGCACGAGTTAC
GGCAACAAGCACCTTGGCGGCCAGTGGCAGAGGTGCGGACTCTGGTCCAGGGAGATTTGTAGAATCAGCATCCTGGCCATTGTCGTCCTGCACTCCCGCA
TCCAGGATTTGAGCGGGTTTCATCAGCTTCTCGTGGATCTTGGACACCAATTGCAAGTGTGTCAGCTCGTCCTCGTCCTCAACCTTCCAAGACTCGTCAA
GCAGTAGCGTCTTAGATGTCAAGTAGTCTGCCGCCTGGTTGAATTCACGCTTAACGTGCACCAGTCTGACGGACTTGAATCTTGGTCTCAGAGCTTCATA
CTCGGCTAGTTTCCTTTGTAGGTTTGGTTGGTGACAATTGATCAAGCCTTGTGCTTGTTGGATGATGATCCTGGAATCACCGACCACAACGATCTCCTGG
ACGTCATGTTCTAACACCATGTTCAATCCCTTGAGCAGCCCACTGTATTCAGCATCATTCACGGTCACATCTTCCAAAACAAATCCTTGTGCATCTAGGA
CCTTCCATCCAGGGAGGCGCCACAGAATGCATCCGCAACTGCCACGGCGTGTAGACGTCTTGGCGGCACCGTCGAAACTCAGGATGTGGCCTTCAAAGTC
AGCACCCAACATCTCCAGACTAATGGGAATTATTGGTGCGACTCGACCCTTAGCCGGGATCAAATTCTCCGCGACTTCGTCCAGGTGTTCTCTAGGTGTG
ATTCCTGCATCTAGGATGGCAGGTAGTCCGTCTTCATCACGTTGCACTCTGCGGATCTCCAGATTCCAGTGTGACAGGATTACGCCCCACTTGACGTTCT
TACCGTCTGCCGACTTGGATGTCAGTAGCCACTTAAGCACAGAGTATCGGGTGTATACTACGATCTTTGGACTGTGTTCCACCAGATTCCTGAACACTTC
TAGGACTCGCATGATTGAAATCACTTCCTTCTCGGCGAGCTGGTATCTCAGCTCAGCGTCGTTCAGGACGCGCCCCGTGAAGCGAACCGGATGAATGACT
CCGTCGTACTCTTGGCCTAGTACCGCAGACGCTGCCCACTGATTAGCA