Description :
From Genome Similarity Track
Location :
Scaffold_4227:425- 2108
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_4227-snap-gene-0.1KIF4A protein

Sequence
1683 bases(100 bases per row)
AAGCTCCAGCGCTCGTGATGGAGCAGCCATGCGCGAGCGTGTCGCTCAGCAGCTGCAGCTTCGACGCCGCGTCCCATGCCAACAGCAGCAGCAGCGTCCA
GGTGGCCGTGCGCGTGCGGCCACTGAGCGCGAGCGAAGTAGCACAGGCCAGCGATGCGTGCGTCCAGACGAGCGGCGCGCGCGTGGTGCTCGGCGACAGG
CAGTTGGACTTTGACGCCGCGCTGCCGCCGCAGGTGCAGCAGCTGTGTGTGTACGAGCAGCTCGTGGCGCCGCTTGTCGACCGCTTCTTCGACGGGTACA
ACGCCACGGTGCTCGCGTACGGCCAGACGGGCTCGGGCAAGACGTGCGTACGCATTGGTTTCTGTTGTATTATTATTGGTATGTTGTTTATTAGAAGGAC
TTACAAGCGAGTGAACTGCGCATGTGTGCTGCGGTGTGTATGAGCAGGTTCACCATGGGGAACGAATTCAAGCTCAGCGTTGCGCCTGGCGACCGCGGCA
TCATCCCGCGAGTCATGGACGCCGTGCGGTTCTGTTGTTTTGCGGCGTTGTTGCATCCCTCCAACGCTGTGGGACTTGCATCAAGACTCATGCTAACGAA
TATGTTTATACGTATATGACTCTTGTAGATTTTCCGACGTGTGGAATCCGCTCCTGAAGCCAAGAAGACCATCGTGAAAGTGTCGTACTTGGAGGTCATT
TATTGACTTATTTATGTATTTTTTTGCTCTGTGGGGGTGTTGTGGTGCATACACCCTAACAGCGATGTCCCTGTAAATGTTACTAACAAAAAACTATAGA
TCCTGAACGAAGAGATCTACGACCTGCTCTCAACGAGTGCTGGTAGCGCGTCAACCACAGGTCTCTCTGTGCGTGACGAGGGCAAACGCGGCATCGTGGT
TGCAGGACTGAGCGAGCACAACGTCGACTCGATAGCCCAAGTCGCGTCGCTGCTGCACACTGGCGCACTGCATCGCGCCACGGCGGCGACGGTCATGAAC
GCGCAGTCGAGCCGCTCGCACGCGATCTGCACGCTCACTATGGAACAGTACGACACGGTGAGCGAGGGCGTCGAGGCGCACTTCTCGAAGTTCCACCTCG
TGGACCTCGCCGGCTCGGAGCGCGTCAAGAGGACGAACGCCGTGGGCGCGCGCTTCAAGGAAGGCGTCAACATCAACCGCGGTCTCCTGTCGCTCGGCAA
CGTAATCAACGCGCTATGTGACCGAAGCCGCCCTGAAGCTGTGGCCGCGAGTTACGTGCCGTATCGCGACTCAAAGCTCACGCGTTTGCTGCAAGACAGC
CTTGGCGGCAACAGCAAGACGCTGATGATTGCGTGCGTGAGTCCAGCAGACGTCAACTTTGAAGAGACGTCCAACACGCTCCGATACGCGGCGCGCGCAC
GCAACATTCAGAATAGCGCTGTCGTCAACAAGGAGATGAGCGCAACGAACGAGGTCGCGTACCTCAAGGGGCAGATCGAGCTGCTGCAACTGCAGCTCAT
GCAGCAGTCCAAGTCCAGTCAGGTTCGCGGACGTGCGGCTGCGAACGCGAGCGGTGAGCAAGTCCAGAATGCGAGTGTCAGTGACCTGGAAGCAGAGCTT
CAGAGGTGGAAGAACGTTGCGTGCACGCGCGAGGAGGAGCTGCGAATGGTCATCAGTGCGAAGAACAAGTGGAAAAGGGTAGC