Description :
From Genome Similarity Track
Location :
contig_28:424962- 426899
Transcript NameFunction/comments
g6660.t1XP_002998463.1 myosin-like protein [Phytophthora infestans T30-4

Sequence
1937 bases(100 bases per row)
GATCTGAATCGCCTCCATCATACCGGAGTACTTCAGCTGGCGCGCGCAGTCGTATCATTGAGCTCGCTTGGTCGCTTGAATTCGTTGGGCTTGATGCAGC
GCACGTAACGAGGGTTCGCGAGCGAGATCTTGGCCATAAGCTCCTGGAGCTGGTACCGGAACTGAGCGCTGACGGACACTTCTCGGATGTTTCGTGATTT
GTTGCCCTGTTGGTGCAAACCCTTCTTCATCTCGTTCGGACGCCGGGAGATCGAGTGCTGCTGCTGAGGCTTGTTTCCAGGGATGGCCTCAATCGACTGC
ATGTTAAGGTCGAAGATCCCGCGCAGCCAGTCGCTCTCGGATTGCCGGATGAGCTCCTTCATATCGTCATTCATGGTCTCGTTGTTCTTGTCGTTGAATC
CGCTCGCGTCGTAGATGACCTCGCCAGCATAGTGCTTGATACCAAAGTGCAAGTCTGCGTCCATCTTCGGGTGCACGTAGAACTTGTTCTTGCTGCTCGA
GTGTCCGCTAGACGTACGCCCGAACGAGTTGTGCAGGTTGGACACGAACTTCTTGTTCGCTTCCTCGCCCTTGAGTCGCCAGTTGTCGTCAAGCGAGATG
AAGATGCCGGGCTTGCCGTTCACCTTGCTCTCAATCAGGTCCAGACACTCCTGGTTGTCCTCAAAGTCAATGTGCTTCCAGTCAATACCCTCCTTGGCGT
AGTCGTTCTGCTCCACCTCCAGCATGTGCTGGTTGAAGTGTCGCTGGAGCTTCTCATTGGCGTAGTTGATGCAGAGCTGCTCGAACGTGTTCCACTCGAA
CTTCTCGAAGCCGTAGATGTCCAGCACACCAATGAAGCCCCACTTGTCCTGGGTGCGCGAGATGGTGCGGTTCAGCTCGGACACGAGCCACAGGAACAGC
GACGAGTAGATGCCCTTGGCGAGCGCATCGCGCTTGTCCCGGACCTGCTCCGAGTTCTGCTGCTGCACAATGACCTTGCCCCCCACGTACAGCTGGCGCG
TGAGCAGCGCCTTGGACAGCGCGTCCTCGCTCACCTTGAGCAGCGAGGCCACGAGCTTCATGCCGTCGGCCGAGTCGTCGCCCAGCGTCACGCACGTGTC
GTTCTCCATGGCAAACTGCAAGTTGCCGAGCTGCAGCACGGCGGCCAGCAGCTCAAACACCATCTCCTGTCTCTGTCCTGTGATCCCAATCGTCTCCATG
CACCTCTTAGTAGTCATAAACTCCTTGGCGTCGTCACACTCATGGATGCTAAAGCACTCGCTCTTCCGCAAGTACTCGTAGTCATGGGGCGTCTGCAGCT
GCAGCCTCTCTCTCAACGCGTTGTCCGCGCCCGCCAATAGCTGGTAGAAAATGTGGTAGTTCCGCTCGCCCAAACTCTGCGACACAATGCGCGTCTTCTC
CAGCAAGAAGTTCAGGATCTGCGCGCCCACGATCTTGCCGTGGTGGTTGAACTGGATCTCAATGAACTTGCCGAAGCGACTGGAATTGTCGTTGCGCAGC
GTCTTGGCGTTGCCGAACGACTCGAGCAGCGGGTTGCTCTCCAGCACCTTCTCCTCCAGCTTGCCCAGCGCGCCCGACATGCCGCTATTGGCTGTAGGCT
CCACCAATGGGGCTCCAGCTTCGCCGTCAGGACCCTTCCTGTAGCTTGTGGCTCGAGCCAGGTACTGCATGATGATCTTGGTGGTCTCCGTCTTGCCCGA
GCCGCTCTCTCCGCTGATGATGATGCTCTGATTGGCTGGGTCCAGCGCGCCTCCCTGGATGAGCTGCGTGTAGGCGTGGTCGGCCAGCGCGAACACGTGC
GGGGGCAGTGCGCCCATGGCCTTGCCGTAGTACGCCGTCATCTGGCGCTCGCTGTAGGCGTCCAGCTGCTTGTACGGGTTGATGGCGATGAGGATGGACC
CCACGTACGTGTAGATGAGCGCGTGCTCGTAGCGTTT