Description :
From Genome Similarity Track
Location :
Scaffold_105:42492- 44183
Transcript NameFunction/comments
Phymu_g4419hypothetical protein

Sequence
1691 bases(100 bases per row)
AGCGGCTACTAGTACTTGCTGACGctgtagagctgctgcttctcgagcgccTGAAGGCTTCGAACGCGGCCGTCAGGGCCACAGGTCAAATTATTCCGAC
GCCAAAGGAAAAAAGGGAAATGCCACTGTGCATCTCCCAAACAAATGAAGGATGCAGTGAGGACTTGACGAGATCATGATGTGCCTCCCTATAAACAGCG
CCTTTCCCGTACAACGTTGTACGCCATCACGACGATTGTGGTCCAGATCCGGTGAACGTGGCGGCTCAGCACATTTTTCAAGGCTTGATGTGCTCGTTCG
AGAAGTACATCGTGCTCTTCCCGGTTCTACGCGCCTCCCAGCACGCCATCAGCGTTAAATAACAATACTGGACATGCTGTCTCCGAGTATCACGGTAGGC
CCGGCGCTGTCGGTTTCTGgggcttcttcctgctgttctCGGGTAATATCAATCTGCCAGACCTGATGCCGGACTACTGGATGTACTGGTTCTCTCCGAT
CTTCATGGCTCTGCACTCCAACACGCTGTCTGAGTTCTCGAGCGACGGTTACACGGTTACACGGATGCTCGGAGCAACAAGTTCCTGGACAGCCTTTCAA
TCAAGCAAGATCTGCGCAGCCAACGGTACCTTGACAGCCAGAAATTGACACCTTAGTACTGCTGTATTTGGCGCGGAGTCTGAAGCGTTATTGGTTTTAT
CTGCTCACGTATTGACCCAGCCAGTTCACGTTCAGAAAACCAACTCCATTTGCATCCATGTCGCGCTCCAGAAACATTCTGTTCCAGCCATCCCTAAGCC
ATGCAAGGATATTGTGTAGCACACAGCATCCAACAGCCCAGTTAATTAAATTGGTCATTTCATCCCTGGATCGAAGTTGAATCCGGAGTTAACGTAGCGA
AGACCACCTGCCTTTGAGAATCCCGATTGCATGCTCATTGCGCACCCTTGCCATCGCCAAATAATTGTTGAACTCAGAGTTGGCAGGTCTATCGGCTAAC
GAAGACTTGTACGCTGGAAGGGTATTTTGTAGCAAAGGATATGCAGAGTCAGTAATGAGATCCAGGGTCGAAAAAGCGACGACTCTCTCTCTAAAACTTC
CCATCCGCTTGAAGACTTTGAGCCGGCACACGATCCAGGGCAACCACAGTGAACTGCTGTAATTCTTTTGTCGTTATCGCAAACAATCTGCATTGACACA
GAATACCTGGATAGAAGTTAGAACCTCTTTCATTGTAAAATTACAAGACCACCCACCTCTTTTTTCTATCCCAGTAGCTGCTGTTGTCAACTGCAGGCCG
CTGTGAAAGGGGCAATGTCGTTCCACCAATGGATCTGACGCAACCAGGGAACCCCTGTGTTGCCATCACTACAGCAATCTCTCGGCGGCGCTCGCACGAT
GGCCACGATATCCATTCAGACCGCACAGCATTAAGGGCGACCAGAACGCGCTTAGTGTAGGCGACAACTGAGCCCGCCGCGACCAAAAATTTAAGGTGGA
ATTCACCCACACTCGCACCGTTACCGTTTTTATCGAGGCGCAATAAGCCGACGGCCAGCTGCAAACAAACGGAGTGTTGTTTATGGTGCGCTTTCTCGCC
AACGGAGTGGAAAAccgggggggggggtccGTTATGTAGTCGTGGAGTGCCACAAAAAATGTCTTTGAAACACGTGTCATCTGCCGAAAGT