Description :
From Genome Similarity Track
Location :
Scaffold_165:42491- 47318
Transcript NameFunction/comments
Phypl_g4550conserved hypothetical protein
Phypl_g4551hypothetical protein PHYSODRAFT_471024
Phypl_g4552hypothetical protein

Sequence
4827 bases(100 bases per row)
TGAGCGCAAGGTGTCAGACGTCAAGAACCAGGACATCCCCTTCATCATGAAGCAGGTGCGGCTCGAGGCTTTGGCACACAAGCAACTATAGCAGTGTTGC
ATAGCATTGCTGTCGTTTACTGCTGGTTATCTAACCTTTTTTATATATTGGATATTTGTTCTGAAGCTGGAGCGTCTTCGCAACTCTAGCGGCCGCAAAA
TGACGCACATCAAGAAACCAGTCATCTCGAAGCGTCCGACCATCCAGGGCATCTGGCAGCCGGACCTTGACTTCCCGGAGTTCAAGATCAGCGACCGCAC
GTAGACGTCAATGCTGCTAGTCAGGGGGTGCAACTTCAGGTGTCAGGGTGTCGCCATtcctgtgctgctgcggattGCCAAGTCGCGTGCAGGAATCACA
GCTCGTTTAGCAGGTATGATGGCCTACAGCTCTGAAGATTGCAATAGCAGTCCGCAGGGCTCTCTCAACAAGTGAAGCATCAAATATATTCCTTCAACAG
CTGCCGAGAGACAGGAAGAGAGGCCCGCCACCTCATCTCCCTCTCCTCTTCTCATCTAACTCTTGTGGATCACAAGCCCgcagacgtcgtcgtggcgctg
caggccgcgGCAGCTAAAAGTTTCAGCACCTGGGTCCTACAACCGGCTTAGAAACCGTGCAGCACCACCTGGGCGTCCGTGCAGATCTCTTGGTCCAACA
GGAACTCGCGGATGTTGGTCCGCTGGTCGCCGGACAGCTGAATGatctcgcccagctcgtcgtccttgacgaTAGCGCCGTTGCAGCTGAAGTTTTTCTT
GAAGGCCTTGAGGATGCGCTTcacgtccaagtcgtcgGCTAGGCCCTGCACGGTCGTCAGACACTTGCGAccgttgcgctgctgcacgcggaCGTGAacc
ttgccgccgccgatgctcgagtcgtccttggcgtcggcgaagGCGTCTGCAGAGCGGGAAAAAAAGTGGTAAACGTATCAGAACATCGCTCCGCATCTAC
CACACGGCGTAATACCCACAGCGTCGCCCTATTATCGCCACGAAAACGCACCGAAGGTCTGGAAGTTCTGGATGTCGGCCATGTTCGCTACGTGTACGAG
CCTGTCGGTATTTGAGTGGCGCGGATTCTCCcgtggccttctcgcgcGACACGATTGGTCGAAAAGACGCTCGCCACCACATCACTCGTACACAATCGGA
GCCTCGCTTTCATTGGTTGCAAAATCTACGTTGAAGCCGCGAAAGGGTGCGATCCTCAGTCGGAGGCTGTACCAACAtgggcaacgcgctgctgctcgcg
gtcGTGAAGGACCGacaggccgtggcgctggccgacgtcATCCTACCCTTCGACAATCTGCGGCTGCATGAGGTCGAGGCGTTCTGGCGCGCGTTCTACG
ATTCGGCGACGAGCTTTGCGCTGTCCAAGAGCCAATTGCGCTCCATCTGCTGTCGCGCAGTCACCTCGGGCGTTTCGAGCCTGCAGAGCTCCAATTCACG
CGTTTCCGAGTATGCAGACGCAGTCTTTGAGTTGTTCGCTGACCCGCTGACGCAGAGGCGGTGGCAGCAAGTGCACCCGGGGGCTCGAGGACTGCAGAGT
CAGCAGTTTCAGAGCCCAAGCGACAGCTTGGCAGCGATCGACGCACTCGAGTTCCTCTCGGCAATTGCATTCATTTCTGCCATTCCGCTGGATGAGAAGA
TTGACCTGCTCTTTGACTCGTGGGATATGTCGGAGGATGGAGCGCTGGACTTGGATGAGTTCACGATATCATTGAAGTCGACGCTATCGGGACTGGCGAA
GATCCTCCAGCCGACTTCGAGCCCCATGGCGACGAGCTTGGATCTGTCGGTGGATGAGGAAGAAATCATTATGCTTGCTGAATCGACTTTTCGAGAGATT
GCCAACTGTGGGGTTTCATTGTCAAAGGATAAAGTATCAGAACTGGAGCCGGCTACTATTACGTGTGAGCAATTTCGAGAATTCTGCGTGAAGAACAAGC
GAGCGAAAGAACTCTTTGATTTTTTCGATGTGGCCGATGCTAGCCTTGAAAAGCGTGTCCTTGATGCGGGAGAAGAAGGGGCGTCATTGGAgactgctgc
aactgctgaGCTGGTGGCCAAACTTGAAAAGCACTCCGATCTAACGGAATCTTCGACGATTGTAGGTACGCTGGTGGACGCTATGCAAGATGATGTTGGT
GATATGTTCTTAGCTGTGAAGCCGTGGATTGGGGCGATTGTTGCTCCGAGCAAAATCCCAGCACTCTCTAAAGGAGCGCCGTTGGTCTCGATCAAGCTGG
ACTGGATATTCGGCTATAGCGCACAAGATTGCAAGAACAATGTACGCTTCGCTGCAACTACGGCCGATGCTAAAGCTGGACGCTTTGAAGAGATAGTAta
tccagctgcagcagcatgcgTAGTTCTAAACACAAAGTCGATGAAGCAACGCTATCATCTTTCCCACACAGATGATGTGCTGAGCTTGTGCCTGCATCCA
CGTCTCCCCTTAGCTGCAAGTGGTGAAATTGGCAAACAGCCAAAGATTATCCTTTGGGATTTAGATACGATGGAGGTTCAGTGCATCCTGCAAGGGTTTC
ACAAGCGCGGTATCTTGCAGTTAGCCTTCCTTAGCTCTGAAGTGTTGGTATCCATTGGTGGGGACGATGACCACGCTATTGCAATTTACGAGTCGAGCAG
TAACTGGAAATCTGCAGTACTGAAGGTTTCAGTGAAAGGCAACAAAGCGGTCCCGTTCCATATCACGACGAACCCTCGCATACCTAGCGAGTTTGTTACG
TGTGGCCAAAAGTACGTTGAGTTTTGGTCCCTTGACGGAAAAGATCTCGTGTCGAAAAAAGGTTTATTGGGGAAGAAGGGATCTCTCCAGCCTTTTCCTG
TGGCCCAATATCTCGAAACAACAGACCAGGCCGTAGTCGTGGGAACAAGCGATGGCTGCTTGTACCTCTTTGTGGGGAGACAGTTGACTAATGTCGTTAA
GGCGCATGAAGGAGCCATTACTGCTTTGTTCTTCTCCTCAGGGCTCTTGCTTTCGGGAGGCAGGGATGGCCAAATCATTCAATGGGATGATAAGCTGAAA
AAGGTAGGCACTCCTTTTCAAATTCAGGATTCACTTGAATCATCGTCACCTTCGCAGTGCAAGGGCATACGAAGTTGCTGCTATTCTCCTGATAGACGAA
TCATTCTCATCGGCACATTAGCGTCGGAGATTTATGAGCTGGATGCTAAGACTGGACAAAACATTCGGTCGGAGCCACTTACTAAGGGACACTTTCAAGG
GGAATTGTGGGGACTGGATGTTCACCCGGCAAAACAACAGTGTTGTACGGTTGGGGATGATCAGACGCTTCGCTTTTGGGACTTGGCGGCACAGCACGAG
CTGGGATTCCTGGAGTTGCCGATACCAGGACGTGCTTGCGCTTACTCGGGAGATGGTAAGTTCATCGCGGTTGGGCTGGGTACTGAGGACTCCGGCAAAA
CTATGAGCGGATCTCAAGCGAAGTCCGCAGTCAATGCGAAGAAACGACAACCTAACGGAGGATTTGTCGTGTATAGTGCTGTTGATTTAACCTGTGCAAA
GGAACCTTGCTTTGATGCGAAACGATGGGTGAGCGATGTCAAATTCTCGCCCAACAATCGAACGTTGGCAGTAGCGAGTCACGACTCCAAAATCTACTTG
TACAACGTGCTTAAGGGTTTTTCTCGGACTCATGTATTCAACAAGCACTCGAGCTACATCACACATATGGACTTCTCATTGGATGGAAACTACATGCAGA
GTACTTCAGGTGGATACGAGCTGTTATTCACAGAAGCTATGACGGGAAAACACATCACCAATGCCACAACCTTTCGAGATGAGTTATGGCACACAATGAC
AAGCACATTAGGGTGGTCGGTGCAAGGAATCTGGGAAGCAGAAAGCGACGGTACAGACGTAAACGCTGTCGACCGATCTAACAATAGGAAGCTACTGGCA
ACTGGCGATGATTTTGGGAAGGTGAAGATTTTCCAGTATCCTTGTGCCTTGGAAAAGGCTTCGTTTCTCGAGTTGCGTGGCCATGCTTCTCATGTCACCA
ACGTCAGGTGGTCTCCTGATGATAGCTATATCGTTTCAGTCGGTGGAAACGACAGGTGCGTCTTTGTATGGAAACACGACAAGCAGCCCACCGAAAAGGA
CAATTTCAAGCGGCGTCTCAGTGAGACTGACAGTGACAGCGATCGAATGGATTTACTTGATAAAAGAGCTGATGATCCTTTGGAGGTGGTGGCTACGAAC
GATGACATCGGCGATGAATTCATGGCAGTACGACCGTGGCTAGGGGCTATCGTGGCTCCTTCGAAAGCTGCATCAATGAAAGTGGACAGCACATCTCCAA
ATACAAGGCTTGAATTGGAGCGAGTGCACGGCTATCAAGCTCAAACTGCCTCAAACAATGCCCGATATGATTCAAAAGGCAAGGTGGTGTATCATACAGC
CGCGCTAGGCATCGTATTTGACAAAGTGGCTCAACGTCAAGCCTTTTTCAGGAGTcacgatgacgacgtcgtTGCGATGTGTGCCCATCCGAATGGCACG
ACGTTCGCGACATCGCAAATGGGCAAGAAACCCAAGATCTACGTCTGGGACTCTGCTAGCGGAGAAGCCGTATCACCTTGTCTTGAAGGATTTCACCAGC
GCTTTGTGAACGCTGTTTCCTTTTCAAGTGATGGCACAAAACTTGGAAGCGTGGGTGGAGATGATGACCATTCCATTGCAATTTACAATTGGCAGAGCGG
TGTATTATCCGCGCAATCTCGTGGAGA