Description :
From Genome Similarity Track
Location :
Scaffold_800:4249- 8447
Sequence
4198 bases(100 bases per row)
CGGAAGATGAGCAAGTCTGTTACCGTGAAGGCGGGAATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGA
AGAAGTCACGATTGATGATATCCAAGTGGATCCGGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTG
ATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGGTGCGGAAGGTGG
CACCTCAGTTCCGGGAAAAACTATCGGACCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCGACGTCCCCGTGGGCATCCCCAGTGGTAAT
CATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCCCTAATCAAC
GAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCAATAT
CCGCATTCATCACACCGTTTGGCCTGTTCGAGTGGAACCGGATGCCATTTGGATTGAAGAACGCACCCCAGATCTACCAACGCCTGATCGATAACGCCCT
CTATGGGTTCACCCGAATACCGGAGCCCGAAACGGGTGGATCCGGGGAAGGTGACGCAGAAGTGGATCCATTCGAAGCGGGGGAGCCAGGGGATTCTGGG
ACCCCATCTGTGTTAGGACGCAGATCTTACATCGACGACATTCTGATTCCGGCGGAATCGTGGGATCAGTTGTGCGAGAGAGTGACGTCCTTACTGGAGG
CGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGAGTACTTATGCCATCGAGTTTCCAAGGAGGGATTGGA
GGCGAATTTTAAGGACCTGTCTTCATTAGCCGATTTGTCCTTCCCACAGTCGTTACGGTCGATGCAATCTTTCTTGGACAGTTTGAACTACTACAGTCGG
TTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTACGAATTGAGAGAGGTAGATTTCGCCGCGATGACCACTCCAGCTGTCCAGATGAAAATCCAAC
AAGCTCTGGCCCAGGAGATGTCAGATCCACGAAGGGATCCAAGTGGTACGACGTCAGAAAAGGACCTAAAACAGGAGCTAGAGCCACCCCGGGACCAACA
GAGAGAGGATCCAGGCTGGATAGAGACGACGGATCAGAACATGGAACAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAAC
AGGATCGCGACCACACCTATACTCCGTCACTTCGATCCGGAACGTCAGCATACGGTAATAGTTTATGCCAGCGACTGGGCACTCTCAGCAGCTCTGGTTC
AAGAACATGAGGGGATCTGCTATCCAGTCACCTTCGTCAGCCGGACACTAAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCT
CCTGCGCGTGTTGGATCTGAATTACAACCTGCTAGTGGGAAGACCCATCCGGATCCTGACTCGACACTCCACGCTAGCCTGGCTGTTCAAGTCGGCCGGG
TTACAAGGACGTTTGGGACAGTGGACAGCTTTACTCTCGCCTTGGACGCTGGAGATTGTGAAGTGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGG
CCGCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTGACTAGGATCGCCCCTAAGAAAGAGCCCAAACGCCGGATACAGATCCCGATCCCGACGGT
ACAGGTGGATGAGGATCTATACGTCCTGAGTTTCGATGGATCCGCTTGTGTACGACGCGGAGGAGGAGCATACAGTGCAATACTGTGGAGACTGCCCGGA
TGGGAAGTTGTACGAGCCAGATCCACTTACGCAGAAGGTCTCACCGTCAATGAGGCGGAGTATAACGGACTCCTTCTGGGTTTGGATTTACTAAAGAAAC
AAGATCCAAAAAGGCTGGTGATTTGTGGGGATTCAAATTTGGTAATCAGACAGGTGCGAGGCGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACG
GCAGAAAGTGATGATCCACCTGCGTGGATGGTTGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCAGACAGCTTGGCCAGTGCCGCT
TTACGAAATCAATGTGGTGTCGAAGTGGAGAGAGAAGCCGGGCATCAGGATCTCGTTACATTGAACCGACTAGACGAAGTGGTGGTAGTTGGATCCAGGA
AAAGAACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAGCCCCCAGATCCTCGAGGAAACATTTGTGAAGGGAGTCCGTATTGA
GCGGATCCTCAAAGCACAAAACGAGGAAGCGTGGATCGTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAGGATACTAAATCC
TACAGTATTATCGCTACGGATTACGCAGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGATGA
GACTGGTGATGCCAGAAACCTTGCAACAGGATGTCCTACACCACTACCATGCTAGCCTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGAT
CCTGGAATGTTTCCACTGGAGAGGACTATTCAAGAGCGTACAACGATATGTCGGTGAATGCGTGGATTGTGAGACAGGCAAGGACAGGCCCACAATCGAA
GGGGAGTCACCTGGGAATATCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAAT
TGTTGATTTGGGTGGATTTGTTTACCGGATACGTGATAGCCAAAGCTAGTGCGTCTAGAACTGCGCAAACCATTGCTGAATCGTACGAGGAGTGCGTTTT
CCGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGGGGCAGCGACAG
CGAGCAACCATGGCATATCGTCCCCAAGCTAACGGATCGGCCGAGCGCATGGTGCAGACAATCACGAGAGCACTCAAGATGTATGTCCAGGATTTGGATC
AGAAGGATTGGGATGAGTACGCAGAGCGGCTTCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACACCATTTTACTTGGTACATGGATG
GGATCCCAAATCCACCCTGGAAGCGGCCATCCCAGTTTGCAGCACCAAGAAGAGGAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTAC
CGGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGATACAGGGTCGAGCGGATCGACACAACGAAGATGCCCGTCCACATCAAATCCAAGTAG
GATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAGGGGTATGCCCGCAAATTAGCCCACCTATGGCATGGACCGTTCCGGGTGAGCGAGAAGATTGG
AGAACATGCGGTAAAGCTGGAAACGGTAGGTACCGAATACCGCCTGTTCCCTGTGGTACACGTATCCAAGCTGAACTTGGTCAAAGAATATCCGGATCGG
CCGCAGATCCGTCTTTCAGTGGATGTATCCGACCGCGTGGATTTCGACGAAGTCCCCCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGACGACGAGT
TCGAATTCGAGAGGATCACCGATATGAGGTCGGGGAAGCGAACTAGATACGGACGGATTTACCGTGAGTTTCTGGTACATTGGCGTGGATATGACGAACC
TAGTTGGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGAGGGATCGTACGAATCGTAACAGATTCGGCGTGATGCAGTCTCAT
GAAGAAGAGTAGGGAGGGGACCCATGGATGTGAGTTGGTCATGTCGATGGGAGGATGAAGAAGGGCCCACAGGAAGGGTGTGGGCCAGGAGGAGGAGG