Description :
From Genome Similarity Track
Location :
contig_32:424850- 426603
Transcript NameFunction/comments
g6241.t1hypothetical protein PHYSODRAFT_482112
g6242.t1hypothetical protein PHYSODRAFT_481470

Sequence
1753 bases(100 bases per row)
TTGCTGGGCCTTTGCAACTGTCGCCGCGTTGGAAGCCGCACAGTGCATTGCCAACGGCGACAAGAAGGCGCCGTCGTACTCGGAGCAGCAGCTTGTGAGT
TGCGATACCAAAGACTTCGGCTGCAACGGCGGTGCCCCTGTGTACGCAATGGAGTACGTTCGCGACAACGGCGTCTGCACGAAGAGTAGCTACCCTTACT
CTTCCGTGGACGGCGGTACTGCGGCCGCGTGCTCGACGTCGTGTACCCCCACCAAGTCCGGCATCTCTGAGATCGTGCAGCTCCCCACAGGCGACGAGAG
CGCGCTCCTGAGCGCCGTGAAACAGCAGCCCGTGATCGTGTCCGTGGCGTCGGACAACAGCGCCTGGAAGCAGTACGTGAGCGGCGTCATTACGGCTTGT
GATACCACGACGGTGGACCACGCCGTGCTGGCCGTCGGCTACGACGCCACCACCATCAAGATCAAGAACTCGTGGGGCACGGACTGGGGCGAGGATGGCT
ACGTCCGCATCAGCCGCAGCACGCAGAACAAGGGCACGTGCTCCGTGCTCACCGACATGTCGTACCCCAAACTCTAACCGTCCAGCAACACAAAATATAT
GTCCCTAAGTGAGTCATTCAAAAAAGGCAACTTCAACTTGCATTCTGGTACCCTTACGTAGCCCTACGTAACCCTACACATAACATAGCTAGCATAGACC
AGTCTAAGAAAAACATAGCCGAGTGTATCCTCACCTGATGCCCGCGCTGCTGCGCCTCGTATCCAGTTCCCGAAGCCGCCTCGCGCTGCGCACCATGAGC
TTGACCCCCCGCCGCTTCGCCTCGTCGCACGCCGACGCCAGGGCCACCGCGCTCACGCGGTTCGTGGACGAGAACGGCGCCATCCGCTGCGGTCAGCGCA
CGGATGACGGGTCCACGGCGCTGCTGGTGGAGGACGACGACCCCCTGGGCAGTCTGAGCTTCACAGGCGAGACCGCCACCATCGAGAAGGTGCTGGCGCC
CGTAGTGCCGTCGCAGATCCTGGGTATCGGCCTCAACTACCGCAAACACGCCAAGGAGACCAACATGCCCGAGCCAAAGTTCCCCGTGCTCTTCACCAAG
GGCGTCAACGCCTTGCAGAACCCGCACGACCCCGTGGTGATCCCCCGCGTGGCGTCGGAGCCTCCCGAGGTTGACTACGAGTGCGAGCTCGCGGTGGTGC
TCAAGGAGGCCTGCTGCAACGTGACGGAGCAGGAGGCGCTGAGCTTCGTTGGGGGCTACACGTGTGCCAACGACATCTCGGCGCGTCGCTGGCAGGGCAA
GAAGGGAGGAGGCCAGTGGTGCCGCGCCAAGACCTTCGACACCTTCTGTCCGCTGGGCCCCGTGCTCATGACCCCCGAGGTCATCCCCGACCCGCAGACG
CTCGAGATCGCCACGTACCTGAACGGCGAACAGGTGCAGAAGTCCAACACGAGCGACATGATCTTCTCCGTCGCGAAGCTGATCAGCCAGCTCTCGCAGG
ATTGCACGCTGCCCAAGGGAACGCTCATCCTCACGGGAACCCCCGAGGTGAGGGACTGTTATGGTGCGGTTTTGTTTGTGCGGTAGGTCTTAACTGTGTT
GTGGTGTGTTACTTTCCAGGGTGTTGGCGTCGCGCGCAACCCGCCTCTTTACCTCGCCCCCGGCGACATGGTGGAGATCGAGATCGAACACATCGGCAAG
CTCGTCAACCCTGTCGTCGGCGCCTCGGCGCTGTAAGCGCATAAGTGGCACCC