Description :
From Genome Similarity Track
Location :
Scaffold_10:424777- 431306
Transcript NameFunction/comments
Physo_130162hypothetical protein
Physo_130163hypothetical protein

Sequence
6529 bases(100 bases per row)
CTTGACACTCTGCGTCACCTTGGTCTCCGTAGCGCCATGTCCCCGCTTGACGCGCGCGATTCTGCGCGAGGGTCGCTCTCAGCTGGGAGGCGGCGACTTC
GGGCGTGTTCTTCGGATCAGCTGTCTCCCGTCTCTGGCCTGTGACACTTGCGTTTCCGTTGATTACGCCACTGGATTCTTGGGGTCGGGTTGCAACTTCA
GGGTTCTGAGCCACTGACGACCTCACATTTGTTGCCAAATCAGGGGTGACGGTTGCGCGACGCGCTTGAACTTGGGCCAATGTTGCACGAAGGTCGCGCA
CTTGGCCGGCGTGGAAGCGCTGGATATTCTCGGAAGACTCCCGCTCTCGCTCTTTCTCCGCATCAAGTTCTTGGACCTTCTGCTCCATGGTTGACATTTG
TTCCTTCCAACCGGCGTAGGTCTCGGAAACCTAGCGCGCGCGCTCCGAGTCGGCTTCGGCTTCGTGCTGTTGCCAGCGCTCGGCGTAGGCGGCATCCAGG
CGCTCACGCTCAAGACGTACAGCTTCCGTGATACTCTGGGTCATCCCCTGAGTTTCAGTGGAACTCTGGGTCTGGCGATCCTCCACGTCCTGCGCCCGCC
GTTCCGCTTCTCCTCGGGCGATCTCAGCGTGGACCAAGCGATCCGTAAGTTCCTGGATCTGGCGACGCGCGTCCAGGTCACGTTGTCCCCTGAGGCGCTC
GCGCTCCAAGGCATCCAGGCGTTCTCTGGCGAGAAACTCGCGTTGCTCCTGTTCCATGCGGGCCTCCCACTCCTGCTGTTGTCGCAAGACGTTCAGCTCG
ATTTGGGCGGGCCCAGACCTCGCGGACACGGACGAAACTGATCCAAGATTCCTGGATCCACTCGAGCGGCTCGACACAGATGATTTTCTGGATTTCGTCG
AGCGTCGAGAGCGCACCTCGCTCTTAGATCTCTGGTGTTGACTCCGCTCATCGGCGCTGACATCCCTTGGACCACCAAATCCAGCAATCGGGGCAGAAAC
CCTGAGTTTCGGCTCGGAAGTCGTGGCTGAAATCCTGGAGAGACCGGCCTTCCTGGGTGCGATCTCTGGGTCAGAGTGCACCGACGATGCCATCTCAACG
TCATCTTGGTCGACTGACACAATACGCGACGGGATGACTGTCCGGGTGACCTGAAATCCAAGACCACCGCCAGCTGCAAAGCCACCGGCACTCTGGGCCA
CAAGCGCTAGAGCTCCAACTCGTTGTCCAAGCGACATCATCGACGAAGACGAAGAGCTACCATAAGACGTTTGAACGCCCGAGGCAGTACTCTCATCCGA
AGCGCGCGAGGTACCGATGACACTTGGCACCGCGCCTGGGGTAGCGTCCTTGGCTTCCGCCTCCAGAGAATCACGTCCATTGGACATGGAATTCAGGGGA
GTGGAATTCTGAAGCGATGCACCAGTCGAAGACTTGTACGCTGGAAGAGAGGACAGCGACGGTGTAGACAGCGCGGATGGCGTTGACGGGACTTGTGGCC
GAGGCGGTCCATGCTGAGTACGCTTGGATCGTGGCTCACCATCACTCGACCCTCGTGGGCTCCGTGAAATCCTGAGTCCAGTGACTCTGAATCTCAGGAC
AAACTGTCGGCCCAGTAGATCCGCATCGTAGTCCGTCATCAATAGATCACCGTCTCCATCTTCCTTGTGGTAGTCCAATCTTGGTGCTTGCTCTTGGGCG
CTTGGTGCGGCGTGATCTTCAGAGTTTACCTTGAAAGGCACACCAGCTATCACCAATCTCCACTCGACCAGTTCCACAGCGATAAAATTCTGGGTTCCTC
CATGACAGAACGCACCAGACTTTCTGGAATCCTGGAAGCACGCGTCGAAGACCAGCCAGGGATCAAATTGACAAACTCAAATCCGGCTTCGAAGAACAGA
GTCTGCAGAATGGCGACGCACTCGCGGGTGGTCATGATACTCTGGGGAATCGTAGTCGCCATGCGATCCTGAGCAGTTCCGACACCCCACCGGGCGAGGT
GAAACTCAGAGATCCAGGCTTCATCTTGATTCTCCAGAGACAAACGCCACTTGAGGTAGTTTCCCGTTGCGTACGCGGCCGCGAAGTACGAGTTGGCATC
TGGTTTCGGAGTCGGCCACTCATAAACGACACTTGGCGGCGTCACCTTCCCAGGATTCACCTCTTCCCAGCGTCGAACTTCACGTCGAACGTACAGCACC
ATGCTCCCGGCGTCCAACGCCGCTGCTCCCGATTCCGGAGCAGGCGCAGCAACTTCCCGGATGTCGCTTTCAGGCGTTTTCCTGGGTGCCGCTTGCGAAC
TTGGCGCTGAAACTCTGGGTTCAGGTGGTGCGAACCCAGAATTCACCTTGGAACTCTGAGTCTTCGCCTTCTCCTTCGCTCGCACGGGCTCCGACTTCAC
TTGACTCATCCGAAGATGAGACCAAGTCAATCACCTCCGGGGGCTCAACTGCATTGGCGCCTCCCTCAGACGCCTGAGCACCGCCCTCGCGGATCCGGGG
GCTCAACTGCATTGGCGCCTCCCTCAGATGCCTGAGCACCGCCCTCGCGGATGTGCTCCTCTGGGACTTCAGGAATCCGCGACCCAGAATTCACCTCCGT
CGAACCTTGGAACCCAGGGGAAACTTCTTCCTCCTGAGTTTGCGATCCAGCAGCAGGCTGACCTTGGACTGCAGACGCCTCGACGTCCCCACCTTGCACT
GCCTCGCTCTCGCGAGCAGCCTTCTTCGCCTTTCGATCGTCGCGGACGACTGTTTCCAGGTCCTTGTGCTCCTCAGGCTCCATACCTTGAATACGACGCG
ACTGACGTGACGCCTCACCGCGTCCTCCGTCACCGCGTCCACTCTTCTTCGCCCCTCGCCCTCCAGGCATCTTGGTAACTTGAAGTTGACGGGCACTCAC
CACTTCTTCAACACTTGATTCCGGTGAAATCCTCGACAATCGAATCCGGGCACGCGCACCAGCTGAGGCGAGGCCGATGAAACCTTTATCGCCCAGGGGG
GTTCGTATAGCGCAGCCCAAGACTGTTCCCCAGGGGTAGACCCAGAGAATCGACTTGAGAGTCAACAGCAAGAAGATAGACCCAGAGATTCGCAGTCGCA
AAGCTTTAAACCCTGAGAATCACACTCCTTGGTTGGCGTGGGTACCTTGTGTAATCCCTGTCGGCTCGTTTGTCTTCGACGGAACGGCACTCCACCGGTT
GGAAATGTAGCCTCGAAGAAGTGCGGGAGCGCACGTCTACTTCAGAACGCACCTCCACACAAAAGGCAAACCCAGAGAATCAGATCCCCTGAAACCCAGA
ATATCACGAATTCAGGGTCAACTCTGGGACTTGGAACTCAGAAGACACCTTACCCAAACGCCCTCCTAGCTCGATAAAACCAACAAATACAGAGTATACA
AACACTACAACTAGCCGTCACTTATTCTTTTGGACCCCTGGACGGTGGGTCACACACACACTAGGCTCACTCGAGTCTGCAATTCAGGGGCCTAGCTCCC
CTGAGACTCACACAAACGCGCACCACCTCCAATTAAGGAGGAAAATACAATCACTATCAGTTACCTTCCCTTCACACAAGCAGTCAATACAAAATCCTGG
AGGCGACTACCTAGCACCCCAGAATACCCTCTGGAGTAATATGAAATGGGCTACCACGAGCACAGCAAGTTACCCAACTAGGATATGGAATAGATGGATC
ACCCCAGGAAGCTCAAGGCCGTCGCTGATCCCCACCTAACTGGACTTGAGTTTGATGGAGCCCACACAGACGGCTGTCCTTCGCCGTTGATGTGCCCTTA
GCGTCCCGCGGTCGTAGTCTCGGGTCCTCCGGATTTCTGTCGGCAGGCTTGGCCGAAGTCACTTGCACAGTACAGGGTAAAAGGAACTCTGTTTGGTTTT
TATCAGCTACTTCTCTCTCTCTCTTCTTCGGGCAAATATCTTCTGTTCACTATGTTTGGGGTCAAAATGTCTTGTCTTGAGTATACCTTGGGATCAGCGG
TCCAAACTTGCGATCGGCTTGCGAATCCATTGTCGCACGGCGCCGAAAGTGCCAATAGTGGGTCCTTAGACTTGGTTTAGTATGGTGCAGGACTCCCTCT
CGACTCCTCGAAAGTATCCAGTCTTTGCATCCACAACGGTTCTTCAAGGTCACGCATCACTTTGATTGCAGACTGACTGCGAACTGACTCGAATCCCTGA
GAATCAGGTGACACTCAGGGTCATCTTCTGAAATCCTGGGAACTCTGAGGAATCTTGGGGAACTGTAGGGATTCTTGGGTGTTGGCTCGGGAAACACTTA
AGTTCAGTATAGAGAGTCTGGATTTATGGTCCAAACCCAGAGAATCATCTTTGGAACTCTGGGTCACCAGTACTCAGGGAGGTGAACTCTGGGTCATCGT
GCGGCACTCTGGGTTTCCGTGCAGCACTCTGGGTAACAAGTCTGCTACATTGCAGGCCTGCGTGCATCTCCACAAAGCCACACTTTTAGCGGGTTAGCGG
CCTCCTGCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGATCCGCATCGTAGTCCGTCATCAATAGATCACCGTC
TCCATCTTCCTTGTGGTAGTCCAATCTTGGTGCTTGCTCTTGGGCGCTTGGTGCGGCGTGATCTTCAGAGTTTACCTTGAAAGGCACACCAGCTATCACC
AATCTCCACTCGACCAGTTCCACAGCGATAAAATTCTGGGTTCCTCCATGACAGAACGCACCAGACTTTCTGGAATCCTGGAAGCACGCGTCGAAGACCA
GCCAGGGATCAAATTGACAAACTCAAATCCGGCTTCGAAGAACAGAGTCTGCAGAATGGCGACGCACTCGCGGGTGGTCATGATACTCTGGGGAATCGTA
GTCGCCATGCGATCCTGAGCAGTTCCGACACCCCACCGGGCGAGGTGAAACTCAGAGATCCAGGCTTCATCTTGATTCTCCAGAGACAAACGCCACTTGA
GGTAGTTTCCCGTTGCGTACGCGGCCGCGAAGTACGAGTTGGCATCTGGTTTCGGAGTCGGCCACTCATAAACGACACTTGGCGGCGTCACCTTCCCAGG
ATTCACCTCTTCCCAGCGTCGAACTTCACGTCGAACGTACAGCACCATGCTCCCGGCGTCCAACGCCGCTGCTCCCGATTCCGGAGCAGGCGCAGCAACT
TCCCGGATGTCGCTTTCAGGCGTTTTCCTGGGTGCCGCTTGCGAACTTGGCGCTGAAACTCTGGGTTCAGGTGGTGCGAACCCAGAATTCACCTTGGAAC
TCTGAGTCTTCGCCTTCTCCTTCGCTCGCACGGGCTCCGACTTCACTTCCACAACAGACTCATCCGAAGATGAGACCAAGTCAATCACCTCCGGGGGCTC
AACTGCATTGGCGCCTCCCTCAGACGCCTGAGCACCACCCTCGCGGGTGTGCTCCTCTGGGACTTCAGGAATCCGCGACCCAGAATTCACCTCCGTCAAA
CCTTGGAGCCCAGGGGAAACTTCTTCCTCCTGAGTTTGCGATCCAGCAGCAGGCTGACCTTGGACTGCAGACGCCTCGACGTCCCCACCTTGTACTGCCT
CGCTCTCGCGAGCAGCCTTCTTCGCCTTCCGAGCGTCGCGGACGACTGTTTCCAGGTCCTTGTGCTCCTCAGGCTCCATATCTTGAACACGACGCGACTG
GCGTGACGCCTCACCGCGTCCTCCGTCACCGCGTCCACTCTTCTTCGCCCCTCGCCCTCCAGGCATCTTGGTAGCTTGAAGTTGACGGGCACTCAGCACT
TCTTCAACACTTGATTCCGGTGAAATCCTCGACAATCGAATCCGGGCACGCGCACCAGCTGAGGCGAGGCCGATGAAACCTTTATCGCCCAGGGGGGTTC
GTATAGCGCAGCCCAAGACTGTTCCCCAGGGGTAGACCCAGAGAATCGACTTGAGAGTCAACAGCAAGAAGATAGACCCCAGAGATTCGCAGCCGCAAAG
CTTTAAACCCTGAGAATCACACTCCTTGGTTGGCGTGGGTACCTTGTGTAATCCCTGTCGGCTCGTTTGTCTTCGACGGAACGGCACTCCACCGGTTGAA
AATGTAGCCTCGAAGAAGTGCGGGAGCGCACGTCTACTTCAGAACGCACCTCCACACAAAAGGCAAACCCAGAGAATCAGATCCCCTGAAACCCAGAATA
TCACGAATTCAGGGTCCAGGATTTCAGTCAACTCTGGGACTTGGAACTCAGAAGACACCTTACCCAAACGCCCTCCTAGCTCGATAAAACCAACAAATAC
AGAGTATACAAACACTACAACTAGCCGTCACTTATTCTTTTGGACCCTTGGACGGTGGGTCACACACACACTAGGCTCACTCGAGTCTGCAATTCAGGGG
CCTAGCTCCCCTGAGACTCACACAAACGCGCACCACCTCCAATAAAGGAGGAAAATACAATCACTATCAGTTACCTTCCCTTCACACAAGCAGTCAATAC
AAAATCCTGGAGGCGACTACCTAGCACCC