Description :
From Genome Similarity Track
Location :
Scaffold_24:42471- 45568
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_24-fgenesh-gene-0.12Conserved gene of unknown function

Sequence
3097 bases(100 bases per row)
GCCAGAGAAAGACACGACACGATTCGCGATCTACAAGGAGGACGAAGTGACAATGGTGCTGGAAAATTTCTTCTCCACAGAGTCGACTGGTGTCGCGGAG
TTGATAGAATCCGACACCTCGCCAGCATCAGCAGTACCACCGACAGCGTATCAGTTCCGAGCTGGCGATATGGTTCACGGCAATGGCCAGCGGTTCGCGT
GTGTGAGCGTCCTGCTCCAAGTACCACCGAAAGTGATCGAGAACGTCACTGTTCACGTGTACCAATGCTTCCCAACGCCACAGAGCGCCGTTCGATTCGC
GAAGCAGATGGTCGCGTCGACGCTGACCGCGACGTCGCTCTACATTGTCCCGCTGTTCGACTGGATCCCGCTCGCTGACCTGGAGCGATTCGACGCCAAG
AACTCGGACCTGGAGCAAGCGCTCGAGGTCGTCATGAACAGCGGGTACGCCAGCTATCGCAGCACGTGGAAGGCGCGCAAAGACGCCATCAAAAAAGCGC
GCGCGCATCTCGGCCACCACCATCAGACCAAGCCAAAAAGCTCCTAAATGCGACTGTTGAAGCACGAGCATGCAATTCCACAGGTACCACAGTACTTGCT
TCGTGCAACATAACGGACAACCCGTTGTTCCCAGGAAGAACATTGACCCAGCACGAAGACGACGATGGCGCCGCGAACNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCTGAACATCTACGACCTCACGCCCGCAAATGGGTACATCTCTGGTATGTTGCGCTTTTGATTGAGGTCTCGGTAGTGCGTCGTGG
CGTCTGTAGTCACTCCCACATGCGTATGCGTGTGTGTGCGTGTGCATATGTATGTAGCTCTTGGGTTCGGTTTCTTCCACAGTGGCATCGAGATTGCGGG
CGACGAATACTCGTTTGCAAGCGGCGCGGGAATCTTTATTTCTACACCAAAGCAAGCTGCAGGTACGAGAGTGTGTATTTTCCGTACAAGATGAACAGCA
GGGATTCATCACTGCATGCACTGATGTTTTCTATGCTTAATCCAATGCTAGGCGCGGTGTTTCGCGAATCGATTCTGTTGGGTAACTTCCAAGGCTCTTA
CACTGAGGCAAAGCAGATCGCGTACTCGCTGCAGTCGGATTTTGAAGGAAACACGTACAACCTTGTGACAAAGTACGGATGTCGCTCCACGGGTTGGCGA
AGCTACCTTGTTTGCTTTTGTTGATGAATCTGGCTGGATCATGTAGGAACTGCAATGCGTACTCCGAAGCGCTGTGCCGAGAGCTGCTGGGAAAGTCGAT
CCCTGCGTACGTGAATCGTGCAGCGTACTTGGGCTCGTTCTTGAGCTGCTTGATGCCTGCGGATCTCGGTGGCCAGGCTCCAGTGGGGGCGACGTCGACT
ACTTCTTCATCATCGCGTCTAACGAACGGGCCCACCTACTCTGCGTTTGCTGGTAAGTTTTGCGGCGAGTTGCCTTAGATATTGATACTGTGTAGAGTGT
GTAGCTGATCGTTAGTTTGCATCATTCTGTAGGTTCTGGACAAGCAGTTGGTGGTACGTCCATCTCATCCAGTTCTACTACAACCAGTGAATCCACACTT
TCAGATCGGCGGGAGAAGTTGCGGATGGCAGCATTGAGACGATTCGAGACTCAACAAAAGTAACGCATCTTTTTTTCCAAATGAGCGAGTCTCTTTTAAC
AGAGCGCAAAATGGGAAATGCAGCTGGCGTGATTCGCATCAGAGCACCCTTTTCATGCTGTGCTACTGCATTCTCTTTTCATGTGCATCTAACTTTTTTA
TCGAAAGCCGCCACACTCGTGAAAACCAAATCAAGTCAACTCGTTGGCCAAAACCTGCTCGGTGCGTCTGGGGTTGATCATATATATATATGGCTTCAGT
TACACATTGATGGCCGTCGTGACGCGTTTCAAGAAGAACCCAGCGCGTCGGTCTAAGAGGTTTTCTGCCCGCAGCGTTTGTTCTTCCCTTCTCGAGAGTG
TCAAATGCAAGAAACAAAAAATAAGGAGATGGGGAAAGCGTCTTCGCCCGTGAAGAAAGCTCCCGGTCCTCTCAATAGCAAAGCAGCGCCGAATGGACCA
CGCGAAGTCGTTGGCGCGCGCTCGTTTGACGATTCGCTGGTCTTGGATGGACGCGTGGAGCGCGTTGAAAGCACGATCGTGAATCGCGAAACGGCGACGC
ACTTGGCATTCGCAAAGAGGTATGTATCTCATTGTCCATGACGCTATGCTTCTGCGCCTCGATATTCTGGAACTAATTGTGGAATAAACGTGTCTGATAT
GCTGTAGCCGGAAAGACGATTTCGCGTTTGCGCCGTCGCCCCATTACGTGCAAATCCTGAACAACTACTGCCACTGGGACCGAGATGCAAGCCACTCGTC
GATCTTGGTTGTCGTAGGCCAGCCAGGAAATGGCAAGTCGGCACTGCTCGCCCACTGGGCTGAAGAGCGTCGTCGGTCAGAAGAAGGAGCCGAGGAACTG
ATCTACGAGCACTACTCTGGATGCTCGTACGACAGCGTCAAACTGTCTCTGTTTCTGTTTCGATTCATGGCGCAGATCAGAACCACGTACATGCTCCGGG
ATTTCGAGCTCCCACGCGAGCACGAGGAAGAAAAACTCAAGTTTTCTTTCGGACGGTGCCTGGAAGCAGCAGTGGGTCGAACGAACCATATCTCAGGAAC
GAACTCCAAGCTCAAGCGGTACGAAGCTTTGATGCATTACTTTACTGCTACATCCGTCGTAAACTGAAAAATGTTTGCCATCTTTTTTAGAATAATTCTA
GTACTGGATGGAATCGACTGCATTCGGAATGAAGATGGCGGAGACTCGCTTTCGTGGCTGCCAACGTCGTTCCCGGCAAACGTGCGAATCATTGTATCGG
CCACGCAAACTACCGTCAGGGGCAAGAACCATTTACGCTGCTGCAAGTGGACCATCCGCAAACCGATTGTGTATGACGATGAGTAAGTGCCTACCTAGTT
ACATTCGTGATATTACTACTGCATTCCAGCCGTTCACGTGATTGACAGCATTTTCTTTTACCAGTGATGATTTAGTGTACGATACATCATTACCACC