Description :
From Genome Similarity Track
Location :
scaffold_213:42469- 43710
Transcript NameFunction/comments
Pl_107614hypothetical protein PHYSODRAFT_423987

Sequence
1241 bases(100 bases per row)
CACCATAGACAACGTTGTTTTACATCCCACATTTCAAACCCATTCGAAAGTTTCTTCCCGCAAAAGTAAACATACAACATGGATGTGCGTAGAAGTGTCT
TGTATGAGCCGAGTTAAACTCTGGCAGAGAAATCAAAGGGATCCTTCACGCCCCAGTCATAGGGTGCTGGTGTTGCGGGAGCTGCAACGGGGCTTTTGAA
AAGCCAGTCAAAGAAACCCAGCTGACGATGACCGTCGTGCTGCATCTGAGGTGGTGGCGGGACGTTGGTCTCAGCACGTAACTTCGATGCTGGGATCGGA
GTCGCCGTATCGCTTGCCGATATTACGCTGACGAGAACGAGAGTGCCGAACGCTAGGACGGATGCGAGATGCATGGTTGTCTACTTGGTCAAGTCGTTTT
GTGAGGTCTCGAGGATGAGATTGCTGGAGAGATAATTCAGAAGTGAAACTCGATCTCTGTTTGGTAAACTCCAAGCTTTGGTACCGTCTGGCTACGATAC
AACGCTATGATTTTACTGCCCTACTACAAGTAGCAGTAATTTCGATCTAAAGATTTGAACTAACATTTCCCAATTCACGTTACGGTAGGTTTTGAAGAGC
AAACGAACTGTGCTGTGGATGGAGCATTTGATACGAACGGTACAATAGTTCAATGAATTAGTCTTCAATCGATTTCACTTATTCACGTGACACTGTGATC
CTTCAAGACCCTCGCTTCTCGATGACATCACTTTAAAGACGGCCACAAGTAGAGTTTCTCCATGTGAGCAGCACCGCATTCCGAGTGTCGATAAGCACGT
TACTACTGGAAGTGAGAACGAGTTACATTTTTATGGTATTACTAAGTGTCATGTAGGATATTTGAGATTGAGTTTTCAATGGCGCATCGTGACTCGAGCG
CGCCGAGCTTCTACTTGTAATCATAAGCTTTGCTCCATGAGGACATCATGTAGAACAAAGCCTCCGTGACCAAACACTCCTGGAGCGGGAAACACCTGCA
TTTCTGGATTGTTTTATCCTGTCTAGTAGGTACATGCATTGCGTCATCGGATTCCACGATACCAGTAGGGGTATCACCGAGTCGTTGTACCGAACAAAAA
CAAACCGCACATCCATCCATTTTTCATTTATTTGAATTTTCTGGTATAACTTTCTACACGGACAAGACTCGCGATGATCGTCAGTGTAAACTCTTCGAAG
TTACCGCGAATGCTTCACTATTGTACTCGTCAAAAGTCATT