Description :
From Genome Similarity Track
Location :
Scaffold_28:4246- 5272
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_28-snap-gene-0.20HECT ubiquitin ligase

Sequence
1026 bases(100 bases per row)
TACGCCGTCGTGAAGCCGAGCGTCTTGATCGCCACAGCAGACCACACAGCTTCGCGCATGGTATCCAAGTCTCGGTGCATGGGGATATCCAGTCGATTGA
AACACGCGTGCGCGTGGATGCACCCCCAGGTCGCGTCCGTCGGCACACCGCGCAGCGTGAACAGACTCAGTCGGCCGTCGTGGCTGGTGAGTGCGCTGAA
GCCGCCTGGAGGCAAGCGAGTCGATCCGGTCGCGTACTGGAGAAGCCGCTGGCGCTGCTCGGCCGAGAGCTCCCGCACGACGATCCAGAAGTTGAAGAAT
GCGGGGTGGAGTCTCAGGTTCCGCGACGTGAGCGTGTGGGCCTCCCAGTTGTCCACGTCGATCTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGGTACGACCTCGTAAAGACCGTTGAGAAACGCAAAGAGCTGACTCTGGA
CACTTCCAAACAATAAATACTGGAGCTTGCGGTCCACGTACTCAAGCTTGTTGGCGTCTGTCAGATCGATCTGACTGCCGTTAGGGACCAACTCGACCTC
CCGCACGGTGCCGTCTGGGAGAGGCATGCTCACGGTAAAGTCTAGCCCAAGCGAGTCGACGCCGTCATTGTCGAGCAGCCATTTGAGGTTCCGGTAGGCT
TCTGGGTCTATGTATTGGAGGTCATGGAATCCCACGGGCAGGCCCAAGATGATCTTGAGCAGCGGCAGCGCCAAGTGAAAACCCGTGACGTTGCCTTCCA
AGAGCGCACGGCCCAGCAGCCGACCGGCGGCAAAGAAGTAGCCCAAGTGGTGCTCACCCAGCATCTCGCGCGAGCGGGGATTGAGGTAGAACGTCTGCTC
GTGCTGGTCCATGCACACAAAAATCCCGGCCTCGGGCTTCACGATCGATTCGTTCAATAGCAGAAACCACTCGCGGTAGACGCCGCCAGCGTCGATGCCC
TGCTCGTCGATAAACTCGACGCGGAT