Description :
From Genome Similarity Track
Location :
Scaffold_1498:4245- 5753
Transcript NameFunction/comments
Phypl_g13559hypothetical protein PHYSODRAFT_469730

Sequence
1508 bases(100 bases per row)
CGTTGCGTTGCGACGTTTAGTACTGCGCACTGCTCGTGAACGTCTCGGCTCAATTTCTTGGGCCCGCAGCAGAACACACCGATCTCTTCCTGTTGGCCGG
AAAACTCATCGAGCGGCTCCATGTGGGCGTGGTTTCGAGCCAcccgcgccagctccgcgttCCAGTCGGGGCGACCGAAGTGCGTTCGCTGCTTGGTTTG
CAGACCCGACACGATGTCTTGGCCCTCGGTGGTGTGGATGAAAGTCTGCAGCGCACGCAAGGGGGCGATGACGTCCTTGCCCTTGTCTGCGGTGTAGAAC
GTGTGGATCTCGAGTCGGTTgtccgtgtccagctcgctgagctcgttCATGGTGCTGGTGAACCACGTGAGCGAATCCTGCTCGCGCGTGACCCAGTAAA
AGTAAATTTTACGGAGCTGGAAAGTGGGTGGGAAGCGCAGGTTTCGGCAGTAACCGCACTGGTAGCTTTTCCACTGGTGCATGATGCTCTTGAGTATCGA
CGCGAACGGAGTCACACCGATGCCTGCACCAATGAGGACGACTTGGCGGTATCGCGCGTAGTCTTGTGCTGGCGAGCCAAACGGGCCGTCCACATAGATC
GTCGGGTACGATAGCAACACTCCGTATCGCGAGTCTTCCAGACCAGATGCAGCGTCTTTCGTGGTCAGCCCCTTGAGTCGGTCGTACAGTTCCCCAGTCC
AGTCGCCACTTTTCTCGACGTGAAGACTCAGGAATTCATCTTCGGGCGCCGACGAAATCGTAAAGGGATGCCACTCGAACTTGGAGATTTTGGGGACGTT
GACGAACACGTACATCCCTGGCAAGAAGCGCTGTCTCCTTCGGAACGAGCTGGGTTTCCTCATGGAGATGGCGACTGTTTTCTTGAACAACTGAACCTCC
GTGATGGTCGTCATGCCACCAAAAAGGTCCCCCATGCGATAGCGCTTTTCGATGAAGTAGATGAGGAGCGGGGGGAACACCCAGTAGTGTGCTTGTGGAC
GGGACACCCAGCTCGCAAAGCCGTGGAACGCCATCAGCACGAGGAACGGGATGAAGAGCATGTGCAAGAGCCAAAACAGGTTGAAGCTCCCTCGAcggat
cttggacacgcaCATTGCGCCAGCGATTGCAGCGCAGACCAACATGACGAGCCCCGTCCAGATCGGAACTCGCTGTGCAAGCTGCACCAAAGATTCTTCT
CAGACGAAAGTCAAGTGGTAGCACGCCGAGCGTTCCCAAGCCGAGTGGGGCGCTGCGCGTGCGAACTTGACGATGACAATCCACGCGGCGGTGTGTCCAA
GCGCTGCAATCAACAGCACGACACCGCAGATCTTGTGGAACTCGATGTGTTGATCGATGGGGAGGTAGTTGGTGACAACTGGCAGTGCGCGGAGTCCCGT
AACGAGGATTCGACTCGTtggcagcaacacgagcacTGTGTTCACGAGACAAAGGTGTGCGAAGCCCTTCGCGACTTGAATGCAGTGGCCAACGGCCGGG
TCGACGTC