Description :
From Genome Similarity Track
Location :
scaffold_46:4245- 5277
Sequence
1032 bases(100 bases per row)
AGGTATTCGTCGAGTTCTTTGCGTAGCGACAGAAGCCTAATCACGTGCGTGAGATAAGCCTTCGCATTATAGTCCAACTTTCTGTGTGAAGAAAACCACA
GGTAGTTTTcgcattgttcacgctttcaATGAATTGAACGATGCGACCATACCCCTGCCCAGACTCCGGTTCCACGCAATAGTAAAACTTTAAATGGAAT
GGTTGGCAGTACTAATTTTAGTGTGAGGGATCTAAAAATGATTTCTATCAGTTACAACGTAAGAATTATACACCACCAACTTCAGTGAGTACCCCCAGTG
GTACGCTGTGGGAATTGTTAGTGATACCACAAGCTTTGAAGGACACTCTCGTGACTTTAATAGAATGAACACGAGTCTTCTTCGTCCATTGAGAGAGTTT
GCACCGAGCTACTTTGACAATGATTTTGCTGATGGTAAGAAAACAGGTGCGATGTCTGATgtcgatgttcatcttgatcatgtTCGTCAAGTCTCCCAAA
CTATGCGAGACAATAAGCTCTACGCTAAAATATAAAGTGCATTTTCGTTGCGCCTGAGATCCCCGTTTCGGCTGCGTTGTGGGCAACAATGGAGTCCATA
TAGATATAAAGaagtcaaagctatcaaCCTGTGCCAAACAATGTGAAACAGCTGAGACAACCGTTGAGCATGGCaaactatttgcacaaatatacgCGCA
ATTATGCAGCGCTGGTGCGATCTCTAACGACTCCGTCAAAGGATAAGTTGAGATGGAATGATCAGAAGAGCACCAGGAGGTATTCGCCAAAGTGGTAAAG
ATCTTGAGAGAAGCTCCTGCCTTTGCGATTACAAACACGACAAGTCTTATCATGTGGTTTGCAATGCAAGTGATTATGCCATCGATTGTGTGTTGATTTA
GCGCAATGATGAGGATCGAAAGCGATTTGTTTTGTATGAGTTGCGACGACTCCGTTCCGCAAAAAGGAActatccagttcatgacaaagagcttctgGTA
GTGAAGCATGCTTTCGTTTAGCTCCGTGGGTA