Description :
From Genome Similarity Track
Location :
Scaffold_8:424379- 425503
Sequence
1124 bases(100 bases per row)
TGGGTGAACACGGAACTTCACAAGGGCATATTACATTGCCAGGAGCTCCTTGTCATGGACAGGGTAGTTCCGTTTGGCGGCTTTGAGCTGCCGGGACTGG
AACGAGATGACTCGTTCCTGTCCAGCCGTGTCGTCCTGCAGCAATGCACACCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGGCTTCGTCT
CGTCCGGCAGGGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGCTGTCAAAAGCATCCTGGTGCTCTTGCTCCCAGCGCCAGTCGACGTCCTTCTG
AAGGAGGCTCGACAAGTGCTTAGCGAAGCCCGCGTACCCAGCGCTGTACTTGTGAAGGTAGTTGGCCAAGCCCAACCACTTTCGAAGATCCTTCTGGGAT
CGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGAGTCAGCCCGAACGCCCACGTTGCTGACGAAGCAACCGAGAACTTTAATCTCTGGTGACG
CGAAAACGCACTTGTCGATGTTGGCCAACACTCGACGGAGATGTCCTAGATGCACCTCCATGGCCGTCTTGCCTCCCTCGGCACGGCTATGGACGAAAAT
GTCGTCAAAGTACGTCTGTACGAAGGTACGCAAAGGGCGGAACAATTGTGTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATG
ACGAGCCACTCCTAAAGCATGCCGCTTGGAGTGCTTCCCGCGGTGAGCGGGATGTCACTCTCTCGCATCAGGATTTGGTAGTATCCGTCAACCAAATCCA
GCGCACTGTACAGTACGCTCCCGGCCATGTTGTTCAACAACACATCCTTTCGTGGGATCGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATA
AGCGTGAACCAGACGCCACTTTCCGTTCGGCTTCCGAACGCAGAAAGTCGGCGTCGAGTGCGGGGATTTCGATTCCCGCACCCTGCCTGCCTTCGCTTTC
GCGGCGAAGAAGGCATCAATGACCTCGCACTGTTCGCGCGGGAGAGGCCATTGCCTCGTGACACAATACTTTGTGCCGGGCACGAGATCAATCTCGTGCC
GTACGCCTCGATCCGGTGGGAGTT