Description :
From Genome Similarity Track
Location :
Scaffold_1893:4243- 5785
Transcript NameFunction/comments
Phypl_g14338hypothetical protein

Sequence
1542 bases(100 bases per row)
CGAATTTTCCAATCCTTGGTTCTGCATCCTCTCCTCGAGACGGGCGACTTCCGCGTCGTGAAGAGGCTTGGGAATGACAGAGTCCGGGGCCGTAACTGGC
CTCGTAGCGAGTTCTTGTACCACTCGGTCGCGGTCAGTTTCGAGCTCCAGGGATCGATGAGCGCCAGTTACCAATTCTTGCTTCAGGCGTGCGACCTCCG
CCTCAGACTCCTCCAGCGATGTCCTGAGGGCCACGCAACGATCCTCCGTAGCCGACAATTGACCATCCAGGAGCCCGGTGCTCTGTCTTTCCGGGTCCAT
GACGGCTCGAGCACGGGCGACGAAACCGCGGTACGCTGTCAACGTGTTGGAATCCAGTCGACGAAGCGATTCTTCCCACTCCTGGTCCGCTTGGGCCCGC
GCAGTCTCCGACCGCTCCAGGGCCCGggtcagcagcgtgttgacAATCGCACTGTGAAGATCATCCaccgcagcacggcgtcggaTATCGCGCATCAAGT
CCAGTTGCTCCAAGCTGGTCTGGAGGGCGTTGAGCATGTTCAGCACCCGAACCCCCAGCCTGTCGGCATCGAACACATCCACCAGAGGCCCGGCCTAGAG
CTCAGCCGCCCGAGCGCGACGTCCGGATGACGTCGTCCCCGTGAACTCTGCTAACCCTTGGGGAGCCAATATGTTGGCGGACGACCGGTCGCCGCCAGGA
CTCAAGACCTCTagcgtctcgagctgcggcaCCGTCAGCGAAGGCACCCTCACGACCACGTGTGCAACCCCGTCGATGTCCCGGACCTGGAGACCTCTGG
AGTTCCCGACGGCAATCGTTTGGATGTCTTCGACCGAGGTCGGGAGGTAGACGTACGGCGGCGGAGGTGTGGCGAGGCCAGCCAACGCGGCCAAATCAGG
CAAGACGACGCCCCCTGTCGGCAACGTCACCGTGTCGTCATGAAACCCCAGCGTCCCTGCTAGCTCAGGACCAGTACGCCCTCGAGAAATCACGTCGACA
AAGCCACCTCAGATCGCCGACATTAAGTCGTGTGAaggcaggagcagcgcctcgcgcagTGCCCGGTCCTGAGGCGCCAATGCCAGTAGGGGCGTACCGG
TACCCCCCGCAAgatccaccagcgcctgcgcgTCGGCGAGCTGAGACACAATCCCATCCGCCGGTGGACCCTCCaggacgccgtgcagcacgcgcggaGG
AGCAGTGCGCGCTGGGGGAGCATtagccgaagccgaaggaggagcagaagtCGTCATCGGCGAGACGAGTCGGTATGAAGAATGAGCCACCCAAATAGAA
TGGACTTTCCGCCTGGGACGAGGCGACGCATATCACAGACCGCGCCATGTGTCAAGTCCCAACAATGAGAGTCCCCAATCGTGATTGACGGATATCGATC
GCTGTGGTTGGACCCCGGCCCCAGGGTGGCTCGGTCGACAACCCAAGAAGCCGAATCGGTGCTGATGGATCCCGGGACCCGGGGGCACGGGTCAAGATCT
TGAACCCCAATGCCTCGAGCAAGTCTCAGCATgtgtgctcca