Description :
From Genome Similarity Track
Location :
Scaffold_31:42427- 45297
Transcript NameFunction/comments
Phyci_221277Ptype ATPase (PATPase) Superfamily putative

Sequence
2870 bases(100 bases per row)
TGCTCCAACCTCATCATCACGAGCAAGTACACGTACTACAACTTCCTGTTCGTCTTTCTCAAGATGCAATTCAGCCGACTCGCCAACTTGTACACGACCA
TTGTGGTGGCGCTGTGTTTCTTCGACTTCTCGCCGGTGAGCCCCGTGGCTAGTCTTACGCCCCTGCTGATTGTGTTCGCGACATCTGCGCTGAAGGACGT
AAGCGAGGACCTTCGTCGTCAGAAGGGTGATGCATTAGTAAACTCCAGACCGGCGCATATCATTCGCCGTGACGTGCTCAACGAAGTGATGCATATTGAC
GGCACATGGCAGGATATTGAAGTGGGGGACGTGTTGCTATTAAAGGATGGCGATCAGGTGCCGGCAGACTGTATCCTGCTAGCTACAAGCCGACCTGATG
GCCGATGCTACGTAGAAACGGCGAATTTGGATGGCGAAACCAATCTCAAGATCCGACAGGTCGCCAGCTGCACGAAACATTTTCTGACCGCTGAAGAGAT
CTTGGAGCAGCACAAACTTGAGGTGGAGTGCGACGTGCCCAACAAGGATCTCTTTTACTTCGATGGCGTGTTGAGACTTGGAAAGATTGGGGATGAGGCT
GTCGTGGATGCCAGCAAAGAAGATACCGACACCAGTTTGACGATGGACAATTTGATTTTGCGTGGCAGTGAGAGCCGCAACGCGGAGTGGACGCTTGGGC
TTGTGATCTACACAGGCAAAGAAACAAAGGTCCAAATGAACTCTGTCGCTGTGCCGCTGAAGCGTAGCTTTGTGGAGAAGACCTTGGATACCATGTTCGT
GCTGGTGCTGATGTTGCTCTTTGGAATTTCGATTGCTTGCACGTTGGGAAACAACAACTGGAATCTGGATTTGGCCGATGATAAGACTCCATGGTATATC
AAGGAAGACTCGAACGGATACATCTTCTTGAGTTACGTGATCTTGTTTAACAATTTGATCCCGCTTTCGATGTATGTGACGATGGAAGGCGTGCGTTTTG
TCCACGCGCGTTACATCGAGAATGATTTGGAAATGTATGATTCAAAAACAGACACTCCAGCCCAGGTTCGCAACAGCAATATCAACGAAGATCTCGGTCA
AATTCAGTACATTTTTTCGGATAAGACGGGAACGCTGACTTGCAACGAAATGATATTTGCAAAGTGTACCATCGGAGGACTGCGCTACAATGACATTGAG
GTGGACCCCGCGAAACCAGCGAGACCTGGCACTCGTTTCAATGACGGACGCTTGATCGCGCGCTTGAACTCAAACCATTCGACGAAGAAGGAAATCCACG
ATTTCCTGTTGCTACTCACGATCTGCAACACTGTGATCCCGGAAACTAATGTCCCCACGTCGGCTACATCCAGCAGCGACTCGTGTTCAGTTGAGACTCC
AACCATCAAGTACAACGCGTCGTCCCCCGATGAAGAGGCGCTTGTGCTGGCCGCAGCCGATCTCGGCTACATTCTCGAATCACGTGATGGTCCGATATGC
AACACACTCATTCAGGGACGACCCATGTCGTTCGAAATTCTGAATGTGCTGGAGTTTAACAGCGACCGGAAACGCATGTCAGTGATTGTGCGTTTTCCTG
ACGGAAGTATTGTACTCTACTGCAAGGGTGCCGATGACATCATTTTTGATCTGCTCTCGAAGTCTCAGCCACAAGGTGTGGCACATGTGACTCGTGGTCA
CCTCCAGGAATATGCTTCGGAGGGTCTTCGTACGCTTACAACTGCCATGCGTCGTCTTACCCAACAGGAGTACGACCAGTGGAGTCACCTGTACCGTCAG
GCTGAATTGTCCATGGAGGGACGTGCCTCAAAGATTGCCAAGGTGTCGGCCATTATTGAGGTCGAGTTGACGTTGCTCGGTGCAACAGCCATCGAAGATC
GACTGCAAGACGGCGTCGAGGAGTCGATTTGCGCTTTGCGGAAAGCTGGCATTAAATTCTGGGTTCTTACTGGTGACAAGAAAGAAACTGCTCTTAGCAT
TGGCATGTCGTCGCATGTGATCGATGATAACATGGATGTGATTGTGCTGGGCCAGCGCGACAAGGGATCCTTGCGTGCGAGGCTCGAAGAGCTATACGTT
GACCTTGTTGAGGACAAATGGGGGTCAGATGAAACCTCGTCAGCCACTAGTGTTTTGTGGGAGGCCTTGAAGCGAGCAATTCTATATCTGTGGGATCTTG
TGAAGCTGGCTCTTGTTGGGCGCGATGAAGAAGCAGAGGCCCGGAAGAAGCGGAGGCGTTTACCTCGCCGCCAGCATGCTGGCATTGATAATACGCCGGC
AGATAGCCCTGTTCACTACGACGAAGTATATCCGGCACTACCGAACCGCGACCTATCTGAGAACAGCTTCGAGCGTGGTTTATGCGACCATGATTTTGAG
CCGAAGACGGATACGATGACGGGTGGTACTGGTAGTATGAGCAGCGGAGACTACATCGATGAGGAGTTGGAATTTGCCATGGTGATCGATGGCAAGACAC
TTGCTCTGGTGCTGGATGACGACATTAAGTATCTGTTTTTGGCGGTGGCAACACAGTGCAAATCGGTGATTTGCTGCCGCTGCTCTCCGTCCCAAAAGGC
GTCCGTGGTGAAACTCGTTACAGAACCTACACTCATGTTTTCTCCCGGCAATATCACGCTTGCAATTGGTGACGGTGCCAATGATGTACCTATGATCCAG
GCTGCGAACGTGGGTGTTGGTATCAGTGGCAAAGAAGGCCGACAAGCTGTTCTCTCCAGCGACTATTCGATTGCAGAGTTCCAGTATCTGAAACGTCTAC
TCCTAGTTCACGGCAACTACAGCTACAAGAGAATCTCGAAGCTTATCCTGTTTTCATTCATGAAGAATGT