Description :
From Genome Similarity Track
Location :
Scaffold_201:42425- 50654
Transcript NameFunction/comments
Phymu_g6625hypothetical protein PHYSODRAFT_478820
Phymu_g6626hypothetical protein PHYSODRAFT_478820
Phymu_g6627hypothetical protein PHYSODRAFT_311081

Sequence
8229 bases(100 bases per row)
TATTCAACGCGGCTGAACTCCgtggtgttggtgctggGACGGTAAAACACGAATGAGTAGTCAGCGTGGAACGGGCCAGGATGGAAGACACCAACAGACG
AGTAACCAAGCTGATACTGTTCGGTCGAGTCGCCTAGTATCAGCACGTCAGGGAGCgggaaaagctgcagcgatgaaTCAAAGTCCCAGTTGATCGGGTT
CGCCATCAGTGGCAGTGGACACAAATGCGCTTGGTCGATGAGCGTTTTGGCCAGCTAAAATATGATTTTAAACAAAAACGGATCAAGTCAGCAACATCGT
ACGAATCACGCAAGCATTAAACCGTACATGCTTGGAGATATCCGTTTGAGAGACTGAGtggacagctccaccatcttCATCACCCGCCGTTTCTTCGCGT
TCGCTTGGCATCGGAGGCAAAATGGCATGCCGCTGCATCTTTTGCTGGAGGTCATCGCGGAAAATCACAATATCCTGAGTGTAGTAGCGAATCCGGCACG
GATTCGTACTGCAGGTGACATTTGGCACCTTCCGAATAAGCTCGCGAGTACAGAGATCAGGGAGCTGTACACATAAATGAATGTTAGTTTTCCCTCCACC
ATGCACTATCAAAAAAGCTCATCTTTCTTACCGGGTGACGAGGGAATGCGCGTGATGAACCTGGATCATTTGGTCCAGGCACTAGGATGAACCGCGAGTT
TTCAGCGATGCCACGGTACTTCAGAATGAGGTTCCCGAGCTCCTCCAAATACTCTCGTAAATCTTGCAACGAGTTggatccagcacctcctccgATGGAT
GTCGACATGAAATCGCCCATGAGGATGAAAAGCGTGGGCTGCACGCTCTCGAGGCCTTGAAATAACTCATCCAACTTGCTCATGACCTGAGGGTCGTCCA
GATGGACGTCAGACAGCACAATAAATGTGGCGTGGTGGTCACTAGCTTCTAATTCTCGGATCTGATTCCGTTGCTGGGATGACACCTCCACACCTAATGG
GTCAATGCCACCCAAAACTTCCAACGATGCTTCCTTGGTCTCTGGGGGTGGGAACCCCATTGACTAAACACCAATGGCACAATGGATCGAGTTAGTGTTT
CGAGTCCCACACCATCATCGTACACCCAACCTTACCTGAACATGAAGCACATCGTCGATGACTTCAccttccaccagcaccacacAGTTGATTGTAAAGA
GGCCATCGGTGTACGCTGCGTTCGTGAGGTCGATGATAATCCGGGACGTAAAATCTTCCAAGTAAAACCTCTTGCGCTCGTCCTGCCCGAGCGTACCAAT
CACTCGTCGCACCCCACTCACACCCAGCAGTGACTCAATCCGCGACAACTGCAAGGAACTTAGACATGAGTTCTAGGTCAAAAAGCACCAGCAAGTAGTG
ACATTTGCCCTACCTCCATGTACACCGTAGTATTTGCCATCGCAGCCGACGGCGGCGCAAACAGTCGGTTCCGCTTGACACGGAGATCCACAGACAGGAA
TCTGTTCCTCAACAACTGAATTCGCGACTCTGGTCCAGCGTGGAGTCTGCGTTGAGCGTCTGCTTTGAGTTCGAACGAATTGTTGTGGGCATTGAAGTGA
AGCCTCGGAGTGTCAAAGGCTCCGAATACTTGGATCTGCTCGTAGTCATTCTCCGCCGATACAGCTAACAGCGTGTCTAAGGCGCTCTCTAAAGCTTCCA
ACGTCACTACGGACGACGTCACTGAATCATTCAACAAGTAGCGTCAATAAGTTTTGCATTGCTGTTGTAGAAAGCCTTTTCTGATGGAGACGTACTCTTG
CTACGGTCGATGTTGTTCTTGATCGCGTAGATAAcatcttccagctgcaatGACGCCTCACTGCAAGCAGCAAACGAAATAATTAATTATTGTCATTAGA
GAAATCATACGCTTATCCTTCAAGCAATCGTTTCCAAGCGGCTACTGGTATATGGAGGTTCAAATTGTACACACAACAGTGCAAGACGCATACGTACTTG
GTAAGCTCTTCGGTGAGGCGGCGCAACGCATCAGCGTGGAGCGAGAGCCCCTGCAACTTGCATGCGCGCAAAACTCGCTTGGACGCCATACGCTTCCCGC
GTTTTTAGCAAAAAACTGAAAACCgcaaatgtatccatgtacCAATAAATTGGCTgcaagatggctacatacTAGTATATCCACGTGCATGCTGCATGTT
GCATGTTGCAATGGTTTGTATTTTCCAAGATGCAGTCTATACGGTCGGACAGGATAAGGTCTGTAAAAGACGCTTCGTTAACTCCTATCCGAATCGTCAA
AACTCGGAAGATAGGCACGCTGCGCCACTGGCTAGTACGTTTTGTTGCCGCCCTGGCCAAGTCCCAGCACGTAGCTCATTCCCTGCGCGTCACGTACGGC
AGATGTGTCTCCCATCGCTGCTGACACACGTGAAAAAGTGTTCCAGCACTGAGCACTCTGAGGTCGCGCACTCAATCTACAGGAAAAAAATGATTTAGAT
GAACAACACTATGCCACAAATGTTAGTATTCAGACAGCCCCATACCGTTCgttgagaagaagcttcgcGAGTCGAAGATCATCGCATTTGCTCGCGCTGC
ATACAACGATTACCGAGATGTTAGATAGGAGACAAAGAAGCTTTTGGGTTGGGTACCTTCTCCGTACCAGTCAATGAGAAGTTGTTCCACCACGTCTTGG
TCTACGCCAGTaccaccaagaagctcaagctttCCCCGTACTGGCAGCAATTCGTGGGTTGCATCCTTGAATCGTGCCTGTATAGGTAACATTTGCGATA
GAAACGATAAAGATGCTAAGTGGGGTTAACTCATTGGCAAATGCAAGTTTTAAAATGGCGCAAACCTCTGAATACGCTTGAAATCCCTGACAAACGCGCT
TGTacacttcttccagctcgtctggTATAACGATGTTAAGTTACGTTGTACATATGCTCGTATTTCCACATTCGATATTGCAGGTACCTGAAGCAGGAGG
ATAGCTGAACTGGAACGGTGTGAGGCCAAGCTGACCCTCCAGGCGCCCAGTATCGACGGCAGGCTCCGCCATGAGCGGCTCTGGTTGAGGTGTAGTCCCT
GATGGTACGCACGCCAGGATACTCTGTTCACACAATAATCCAACGTTAGATGGAAGTTCGGCCTCCATGAACCACTGAAAACTTACGTATCGAAGCACTC
TCGCTAGCGGATGAAGCCATGCATTTGACATCTCATTTGTGTCTGTACTTGAGGCTGGCAGCACTGCAGACCAGTTGTGGAGGAGCTGTTCGCCCAATTC
AGTCGTGTCCTGGCCTGCGAATCGTAGTCTCCAGTAGAGCTGAGTGGCGTCGCAAAGTGTGGACACTGCATGGGGAGCTCCGTCCGGTTGATACGTGAGG
ATATTCACCTCCAACATTTTGTCGATGCGATCGTAGTGGCCCAGATCCAACATATAGAGAGCCCACTGGAAATACAAGTGGCGTTCAAGTGGCCCACCAT
TGTCAAAGCCTGCCTTGAATTGGTTTGCGTAGCTTGCTCCGTGGTTGGCATTGCCTCGGGCTTCCAGGACGTGAAGCATGGTGTGCACTACACAACCaac
accacagcagcacccgAACAGTTAGTTATGAGTAAAGTTGCGTACCACCTCCCAACAGAGTCAGTACTCACAGGCCCAGCGATCATTTCCATTCATGGAC
AAGGTCTTCTCCGCCAGCGACTCCGCAGCATCcagtcgtccagcagccTGCATTCCGTACGCCTGCATGCCCAGTAAGTGGCTGTATCCAGTGTCATTCG
GTGACCACGAGGGAAGTCGCCGAgtcaccaccgccagcatGTTCTTGTAGTCACTACAATTTCCGACATCCAACATCTTTCACGTTAAGCATCACTCTCC
TTACGTTCCCATCATCAAACTTTAAACTCACCCGAGAAATCGGTAAACAtcgtagcagcagcgcagtGCCAGGAGGTCCGTGTGGTCGTGCACCAGAATC
GTCTCGTacaacgctgcagcttcgcgGTGGCGGCCGTGCACCATCGCGTCCAGTGCCAACACGTGCGCTTTCTCGTTCTCCGTCGTTTCTCCTGCATTTG
GCAACACTTTCAGCACCATTGCAGCATTTCTAAAATCCTCCGTATCGTTTCTAAAAGCCTCCAACCTTCCTTGGCGATTTTACTGGCCATTTGGAGCCTG
GCGACCACGTCCAGCGTGTCCTGATGCATGAGAGGGGCCAGACACTGACTCGCGGCTACCAGCACGTGACCCATGAGGAACGgagcgtcgtcctccagta
CCTTGTGTAGCATGAACTTTGGATGCGAATTCATGCTCACATACTTCAAATTCCCAGTTAGAAACGTTAGAAATGGCATTGACAACGGAAGTCAAAGCAC
GTACATCCAATAATGCCAGGTCAtacgcctgctgcttgctcgtGCTGCGGCTCAACGACGTGTTGCGCGCTCCCTCGAACTCGCCGATGCCGAAGAtcga
gcccagcagcgacaTGGAGCGCGTCGAGCGCCCGCGCAGGAGCGGAGCAGCTCCGCGGCGAAGCATCTTTGATTGATTGTGCGGTGGCAGGTGAATATTA
ATGTACCTTATTAATGGTACACTTCTAAAAAGGCAACTTTTGAGTCAGCTTTGATGTCTTACTGCGTCTCTGGAAACTCATGCAGGGAAGCAAAGGTTGA
AAGTTTTACAAGGACTTCAAGTCCGATGACGAACGGATATGACTCGGGATCGTATGTAGACGCTTGCATTTCCACTTTTATTTTAAATGACTGCAATTTT
CGTTTTCAACACGCTACGAGCACGCTACTTTTGCACAACTACCGACGCTTTCTTTCGCGTCGTTCACTAACATCGAAAGTGTCCTGAGCACTTGGGACAC
TTGTTCACATCATGTTCATGTTCCACGAGTGCAGACCCGACTCACCGCCCTGGGCTTGGTTTGTGGGTGCAGCTTGTGCGCTGGAATTGGCTTCGGACGA
CATATTCTCCAACAAATCGTCCCACGGAGCAGCCTGGCCCGTGCCACTGGCATGATAAGGTTCGCCAGCTCGTGGATAGGCTGTCGGCATGAACCCACTC
CGCTGCTCGTGAGTAGCAATACTTGGGATCATctgctgttggtggtgttgctgctgcatcgagcTGGAATATCCCATTCCTGACTTCTCGGTCTTGACGT
CAGAATACGGCGAGTAATTCGACGGACGCAAAAACGGCTCAGGTTGGTattgctgcggctgctgctgctgctgctgttggccgTAATCGaaagaagtcgt
cgatgatgCAGGTGGAGAGAGGCGGCCGAATTGTGGGTACTGAGATTGGTCCATCGGCGGCGGCTGTAGTCCGAAGCGGTTCACTTCCACATTCGCTTCG
GGCGtgcgcatcttcttcgtagGACGCTCGGGTTGCTGGAGTAATGCTGGAATAGACGGTCCAGCTTCCTGCGAATACACAgacgcactggagctccaTG
ACGCCGACACAGCGCTATTGTCTGCTGGCATCGCCCCTAGCAACGACGGCATGGGGGTAATACTGGCCGTGTTGGCAGGAGAAGGGTGGTGGTTCCacgc
aagaagctcatcgaATTGTCCGTTGCGGAGTAGCTGCATGGCGCGTTTGCGTTTCTTGGCATCGGAGACGTCGAGTCCCATCACGGGTTGGCCGATTAGC
ACTGCAAATTTCAGAAAGTTGGTCACCCAAAACTGCTGAACTGCAAGACACAAGTTTTGCGTCTCGACCAGAGCTCCCTCGTCCGTGTTGTTTTCACGCC
GAAACTGATCCACCAGTTCCTGTCGGAAGATCTGCTCCAAGCGAGAAAGTTCCCGCTGCCTCCGCACGTGGTCCATTTGGTCGAACTGTAGCGCCTTCTC
GCCCTTGCCCGGCTTGGTCACCCTAAACGTCCGCTTTCCCAGCGCAttcttctggaacttcttgGAGAGTCTCATAGTCGAACAGTTGAGCATCTTGGCA
AGCACCAAACGAATGGGCGTGCCGTGCGCCAGCGGCAAAGCCTGGCGGTCAAACTCGCGGAGGATCCCGTCGATGAATTTCTCCTCGGGACGCGTCCACT
TCCCGCTGCGTGGCTCGGGTCGGACCATCATGTTGATGGTCGGCAAGATCGCTACCTGGTCGATTGGCGCCGCGCAGGCCGGACAAGCGTCCAGTGGCCA
CACGTGAACGCAGCGCGAGTGAAAGATGTGATTACAGTTAGGAGCTACGAGAACAGGGTCAGGGTACTGACAGACATCGCACATGCGTTCCATCGCCATA
GGAGCCTCTGTACGAGCCTCGGGGGCGGCCTGAACACGGTAGTCTGAGTGCTGCTGGTAGGTCGCGATGGGCTTTTGTTCCAGCGGAGACTCAGCGTACG
GGAACTGAGAGATGGTGACAGGAGTACGGCTTGACTGGTAGTACGTCTGCTGCGGCGTGTACTGCTGCGGCAGCGCCGACGGCTGGTAGTAAGCTGGGGT
CTCGAGCGTAGGACGCATGCTCGGGACCGAGGGGCGATCTCCCACGGGCTGCTGGCTGTACTGATTGCTGTATTCGTAGTCATATTCGGGCGGTTGGTGC
CCACCACTTGGCTGCATTCTTGAATTCTTGAAGACTGGCTCAAAGACTGGTGCTCGGGTCTCACAAATCATAAACGCCGGGGGGACGGAAGTGAACGAGC
GATACAGGCTGGTTGGTTCGTTGGTTGGTCGATTGGATACGAACTTGACTAACGCCGCTCAAGTGAAGCTTTTGAGAAGTAATGGATGAATTCCAGAGTG
AGGCTCAAGTGGGCACGTCCTCGCCGAGGGGGAGGAGCGTTGAGCGGCTGGCTGGCTCAATTCGGCAGTGGCAGTATCAGTTGATACAGAACTGTAGACA
CACCACACAGCACAAGGCACGAGAAGGTCCAGGATTAACTCCTCGTTTTTGTGTCTCGCGCTTCCTTTCCCCTTCTGGCGTTGGCGCTCGGCAGTGGAGT
TTCCTGTGCTGGTGGGGTTAAGGAGAAGCCGAACAATCGCGTTCGTAGTCGGGGGCGATTTGCTGATGCCGCGCGGTTGTATTGTGCGACGTCGGCGCTC
GCCGAAAATGCACACGGGGTTGagcaactcgctgctgctgcaattggcGCTGTTGCCGCTGGCCGCATGACCCGGTGCTGGCCCGTCCCACTACGTCAGC
GGCCGTTGCAAAGTGGCTGTCCTCGCGGAAGCGAGCATGTGTGGGCCACGTCGCGTTGACTCAAGGCTGCGTTGCAGGCAACACACGTTCAGGTGGGACT
GCAGTCCATCGAagtcggtacatgtacatgccacgctggacgagccgGTGCCGTGGGCACCTGCCTTGAGCTCGATGCAGctccttgctgctggtgaaca
ACATCGAATGCAGTGCCTGCAGCCCTGCTGGAAGGCTGACTGCAACCGTCTGGGTAGCAGACGGTCGGACGGCCGATCCTCGATCGCGCGGGACGGAAAG
GTCCGGCAGTGCAGTGCGAGGATAGGCCTCCGCTCGACCGCCTGCTGGCAAGCACGTACTCTGCTGGCATGTGATGCTAGAGCAGGCTGCTAGACTAAGT
CGGCGTCTAGCCTAGTCACCGACTTAGTCTAGCAGGCCAGCTGGAGGAAACGACCAAGGTAGGATTCAAAACGCTGAAGTCGTGATAACGCCAATGGATG
CTACGCACAGCGTATTAGAACTAGATCATGTGCCAGTTCAGTTCAAGTCCTCAACTGCGTCCTGGCCGACCTACACGCACAATTTCGGGGtggtgcaagt
tgcagtttgCCAAgcagaggaggagacggatGCACCCTACCTCACAACTCCCACCAATGGTGGGCCACCATCGCCACGTGATCGAAATCAAAGTCACTGA
CGGGGTCGCTGATGGATACAGCGCCACGGCGCTTCGTGCGCCTGACAATTTGGAGCGTGGTCGCCACCCCGAGACGAGAGTCCTCGTGTTCTATGTGTTC
TTTAGCGCGCTTGcccgctacatgtagtttcGCGTTGGGGGCTTACGTAGCAAGCGCTTCCCGTCATTGGACAGTACATTACCGGTATCGGCAAGCATGC
TTACCAGGAATTTCGTTTGTGTCCACCGGCGTTGGATGCTATCCATCCGTAATCGACAGCGAACCGACTATGTCATTACCTAGTTTTTGTCAAACAACTC
GCCGAGCAGCGCCGGGCCACGGCAACGTA