Description :
From Genome Similarity Track
Location :
contig_28:424246- 426181
Transcript NameFunction/comments
g5650.t1hypothetical protein

Sequence
1935 bases(100 bases per row)
GATCTGAATCGCCTCCATCATACCGGAGTACTTCAGCTGGCGCGCGCAGTCGTATCATTGAGCTCGCTTGGTCGCTTAAACTCGTTGGGCTTGATGCAGC
GCACGTAACGAGGGTTCGCGAGCGAGATCTTGGCCATAAGCTCCTGGAGCTGGTACCGGAACTGAGCGCTGACGGACACTTCTCGGATGTTTCGTGATTT
GTTGCCCTGTTGGTGCAAACCCTTCTTCATCTCGTTCGACGACGGGAGATCGAGTGCTGCTGCTGAGGCTTGTTTCCAGGGATGGCCTCAATCGACTGCA
TGTTAAGGTCGAAGATCCCGCGCAGCCAGTCGCTCTCGGATTGCCGGATGAGCTCCTTCATATCGTCATTCATGGTCTCGTTGTTCTTGTCGTTGAATCC
GCTCGCGTCGTAGATGACCTCGCCAGCATAGTGCTTGATACCAAAGTGCAAGTCTGCGTCCATCTTCGGGTGCACGTAGAACTTGTTCTTGCTGCTCGAG
TGTCCGCTAGACGTACGCCCGAACGAGTTGTGCAGGTTGGACACGAACTTCTTGTTCGCTTCCTCGCCCTTGAGTCGCCAGTTGTCGTCAAGCGAGATGA
AGATGCCGGGCTTGCCGTTCACCTTGCTCTCAATCAGGTCCAGACACTCCTGGTTGTCCTCAAAGTCAATGTGCTTCCAGTCAATACCCTCCTTGGCGTA
GTCGTTCTGCTCCACCTCCAGCATGTGCTGGTTGAAGTGTCGCTGGAGCTTCTCATTGGCGTAGTTGATGCAGAGCTGCTCGAACGTGTTCCACTCGAAC
TTCTCGAAGCCGTAGATGTCCAGCACACCAATGAAGCCCCACTTGTCCTGGGTGCGCGAGATGGTGCGGTTCAGCTCGGACACGAGCCATAGGAACAGCG
ACGAGTAGATGCCCTTGGCGAGCGCATCGCGCTTGTCCCGGACCTGCTCCGAGTTCTGCTGCTGCACAATGACCTTGCCTCCCACGTACAGCTGGCGCGT
GAGCAGCGCCTTGGACAGCGCGTCCTCGCTCACCTTGAGCAGCGAGGCCACGAGCTTCATGCCGTCGGCCGAGTCGTCGCCCAGCGTCACGCACGTGTCG
TTCTCCATGGCAAACTGCAAGTTGCCGAGCTGCAGCACGGCGGCCAGCAGCTCAAACACCATCTCCTGTCTCTGTCCTGTGATCCCAATCGTCTCCATGC
ACCTCTTAGTAGTCATAAACTCCTTGGCGTCGTCACACTCATGGATGCTAAAGCACTCGCTCTTCCGCAAGTACTCGTAGTCATGGGGCGTCTGCAGCTG
CAGCCTCTCTCTCAACGCGTTGTCCGCGCCCGCCAATAGCTGGTAGAAAATGTGGTAGTTCCGCTCGCCCAAACTCTGCGACACAATGCGCGTCTTCTCC
AGCAAGAAGTTCAGGATCTGCGCGCCCACGATCTTGCCGTGGTGGTTGAACTGGATCTCAATGAACTTGCCGAAGCGACTGGAATTGTCGTTGCGCAGCG
TCTTGGCGTTGCCGAACGACTCGAGCAGCGGGTTGCTCTCCAGCACCTTCTCCTCCAGCTTGCCCAGCGCGCCCGACATGCCGCTATTGGCTGTAGGCTC
CACCAATGGGGCTCCAGCTTCGCCGTCAGGACCCTTCCTGTAGCTTGTGGCTCGAGCCAGGTACTGCATGATGATCTTGGTGGTCTCCGTCTTGCCCGAG
CCGCTCTCTCCGCTGATGATGATGCTCTGATTGGCTGGGTCCAGCGCGCCTCCCTGGATGAGCTGCGTGTAGGCGTGGTCGGCCAGCGCGAACACGTGCG
GGGCAGTGCGCCCATGGCCTTGCCGTAGTACGCCGTCATCTGGCGCTCGCTGTAGGCGTCCAGCTGCTTGTACGGGTTGATGGCGATGAGGATGGACCCC
ACGTACGTGTAGATGAGCGCGTGCTCGTAGCGTTT