Description :
From Genome Similarity Track
Location :
Scaffold_170:42423- 43669
Transcript NameFunction/comments
Phymu_g5988hypothetical protein PHYSODRAFT_486841

Sequence
1246 bases(100 bases per row)
CAAGCTCCAACCATGGCCACCAAAGCTTTCAAGAACGCACTCAACCTCGAGGTCGAACACGCCCCACTCACCCACCCCGAACTGCGGGGCGAGTTCCCCA
CCAAAACATACGACCCGATCCCAGTGCTGCCGTACGAGGATCGCGCGCTCAAGGCTGACCCGACGTTCAAGAACCTGCTGGCCGACGCGACGGTGACGCA
CCTGGAGCCGAAGATCGGCACGGAGATCTCGggtctccagctgcacgagctgtcgGACGCTCAAAAGGACGAGTTGGCGTTGCTTATCGCTCATCGTGGC
GTGGTGTTCTTCCGTGACCAGAAGCTCTCGATTGAGGAGCAGTTGGATCTGGGTCGCTACTACGGCCCGCTGCACGTGCATCAGACGGTCGCTCACGCGA
AGGGTATTCCCCAGGTTCACGTGGTGGAAAATACTGTAGAGGCGAGTGAGAAGAGGCTTGAAACTCAGCTTTAcaagcacttcaaccagTGGGTCTGGCA
CAGTGACGTGTCGTATGAGCACCAGGTAAGAAATATCGCTTATAGATATCGATTTTGGTTGGCTACTAAGTGGatttttgttgttgtggctgcagcctcc
atcGTACACAAGTTTTAAAGTCTTGACCACACCTCCAACTGGTGGTGACACCGTCTGGGCTTCTACTTACGAAGCCTACGAGCGTCTTACCCCTCCGTTC
AAGAAGTTTGTGGAGGGCCTCACTGCTATTCACAGCAGCAAGGTATATTTTCCATGTTAGATGTGACTACAGTGAGTTCACCCGACGTATTGTGGAtgaa
acagcttcaagccgaAGCTACGATTGCCCAGGGGCAAACGCTCCGGCGTCCTATTGTGGAGTTCGAACATCCTGTTGTTCGCACGCACCCTGCCACCGGC
CGCCTATCGCTCTACGTGAACAGCGAGTTTACGACCCGTATCAAAAATCTGTCGGCAGCCGAGTcaggtactgtaccatgTCAAAGCGGGTCGTATAGCA
CGAGGATAACAATCGCTGTTTATCCTTTACAGACGCAGTGCTGGGTTTCCTGACCAACCACATCGCCCAAGGACACGAATTTCAGGTGCGCTACCACTGG
ACCAAAAACGCAGTGGCGATCTGGGACAACCGCGTGACAGCTCATTACGCAACTTTCGACTATTTGCCCGGCAATCGACACGCTGTGCGTGTGACTCCTC
ACGGTGAGATCCCGTACTTCGAGAGCCGCAAGAGTGAAGATCCCGC