Description :
From Genome Similarity Track
Location :
Scaffold_1529:4242- 5243
Transcript NameFunction/comments
Phyag_g10881dicarboxylate/amino acid:cation (Na or H ) symporter (DAACS) family protein

Sequence
1001 bases(100 bases per row)
GCTCGAAGATAGCCATGGACAGGATACTGCAGAGCACAAGGACGCCGACATGCGTTGCTGCTTTCCCCAGCACCTCCTGCCCAGACAACGATCCGGCAAC
GAGAGACCCTACTGCAAGCGGGCTCCAGTCAATCGCCTTGCTGATTACGCGGAAGAAGACCTTGTTCatctgcttgagcacgtcgAGCAGCGGACTGCTC
TCGCGAGAGCTCGTtttgactgcagcagcaccaaagaCGATTGCAAATGTGGTTACGCTCAGCATTAGCCCCTGTTGAAAACTCGAGAAGATGTTGTCTG
GAATGAACTGGTATAGGATATCTGTGACTTGCATGGTTACTGTGGTAGCGGAGCTCGCTGTGCCTTGGGTCAGAAGCACTCGTGTCGGGTCGTAGAACTC
GAACAGCGTCGTAATATCTGTTGAATTGCCTGAGCATGAGGCTGCGCCGGTGGAATTGTACGTCAAAAAGTTGCCGTTTTCACACATGACGTTGAAGAAC
GCCGAGGACGTCTCGACATCTACACCCTTGCTCTGTGGGTGTAGGCTGCGCAAAAGCATGGAGAtcacgagcgccagcgtTGAGCCCACGAACGACAAGC
CCGTGAAAATCAGAGCTGTACGCGTGCCGACAATCGACACTTTCCCCAGCAACACGATGTCAGCAACCGTCGTAGATAAACTCGTGAAGACCATCGGCAC
CACGAAGCACTTGAGAACCTGCAGAAACACTTTACCTGGAAGATTCACGAGACTGCTCACGTCGTCTGAAACATTGAGCTTTAATAGCAGCAttcccagc
agcagacctGCTATCGCACCAAGCATGATTTGCGTCGTCGACTCCCGCAGAAATCCACATCTGCGGACGCGGTCAGGGTACACCACCTCGGGCTGTGGAG
GCGTCGTGTGGAATGGGAACTGGGGGTTCTCCAAGTTGCTGAGGCGAGATTTAGAGTAGCGCGGCATCCCAGCGCGCTCGAACATGCCCGTTATGGGGTT
G