Description :
From Genome Similarity Track
Location :
scaffold_1:424151- 425608
Sequence
1457 bases(100 bases per row)
TAAACAGTGCACACCAAAATTTAGACGTAAAACGGGTATCACGGTCAGACACGATCTCGGCAGGATGgccatgcagacggaaaacaaCGTTTACAAAGAC
CTTAGCTGTCTTCTCGGCAAAGATCTTGTCCGAAACAGGTGCAAGGTGGACCATCTTGCTAAATCGGTCCACTAACGCATGGATGCCACTGCGTCCATGT
GTCTCAAGCGGAAGTTTAAATATGAAGTCCATACTAACAGACTTCCAGCTATCCGTTGGTACTGCCAACGATCGAAGTGGGGCCTGAGTGGAACCCGATG
GTTTCACTCACTGGCAAATCTCACAAGTCCTCATATACTTGCGCACCCACTTCTACATGTGTGGCCAATAGTAATCCCGGGAAAGACTGAGAAAATTCTC
TCACATTCTAGATGGGGATCCTTAGGGTTGTCATGGTACGTATTTAAGAGAAAATAACGGAAACTTTCGTCATGTGGAACAAAAACTTGTGCTGTACCCC
CGTGTTTAGTCGCACAGCACAACAATCCGCCGTGTACTCCAAAGCGGTGAGCACGCGATCTTGTGCGAGACGGTAGACCTTGCGGTGCTTTGTCGAGAGG
TTCATTAAAATACCGCAGTAAGTCCTAACACATCTCATCAGACTTGTACCCTCCGCCAATTTCTTCGCGCACTGTATTCGTAGCTTGCACTATAATTGTC
TGGGCATTTTTGCATTGTCGACTTGACTCGCACATGTTTTCGCTCCTGGGATTTGGACTATAATACGGACGCCTTGACAACGTATCGGAAAATATATTCG
TCTTGTTTGTTTTGTAGTGTAAAAAAACGTTgtactccgcaaagaaggaaacCCACCCACCCATTCTTTGCAATAAATGAGGAGATTTGGCCAAACGCAG
TGAGGCTTGATGtgtatagatcgcaaagcgcACCTTACAAAGCAAGTACATTTGACCCTCATCATCGTTTTGCAACAACGCACAACCGATGGCATAATAC
GTGCATCGCAGAACACATGAAAAGGCATATCAAAGTTTGTAATCGCAAGATTAGAGCTCGactcttcttcactttgGCAAATACCCCGTGGTGACATTTT
GACTATTATCTCTGAACGTTCTTCTTTAAAAAGGTTGCACCAACGCTGCATAGTTGCCCGTGTAATGCAAATAGTTGTTCAAGCGCATCCACTGTTCATC
TGTTTCACATTGTATGGCACAGGCCTATCATTGATAACTTTGGCTTTCCCCGGATCTACACGAGCGTAAGCCGAGAACGGAGATCTCTGGTGCGAAAAAA
ATGCGCTTATGTGATAAGCATAGGTTTTTATCTCGCACAGCTTGGAAGACTTGACGAAGgtgatcaagatgaacatcgacATCAGACTTCTCACCCATTT
TCTTACTATGAacgaatatatcgtcaaagtaacTCGGTGCAAACTCTCTCAATGGGC