Description :
From Genome Similarity Track
Location :
Scaffold_100:42414- 47309
Transcript NameFunction/comments
g8728.t1hypothetical protein
g8729.t1ETI39398.1 hypothetical protein F443_15014, partial [Phytophthora parasitica P1569

Sequence
4895 bases(100 bases per row)
GCTACTTCGATACCCCGGAATGAGTGGATCCCAGGGTATTACTCTCATGCGTATCGCCCAGCAGCTGATGTCGCCCCGTGGGACGTGCGATACGTTCGCC
GTGTCTGCGTCCTGGAGATGGACTTGGATCTCCTTTACCACCATTTCTGTCGCCCCAGGAACTGGCTGATTCCTGTTCGCACTACTCACTCTCGCACTTG
GCGGTCGGATTTGATCACCACCGCCCAAGTGCAGGCGTTGTATGCAACCCGCCCCTGGGAGATCTTCGACACCATGATCGCCCCAATTTCTTTCAGCCTC
TCGGGATGGTTCGTGCCTATGGCTCAGCAGTATCAGGACCTCATCCATGAGCATTCCCAGGCTGTGTGGGAGGCTCTCCATCACTTCACGATCAGCGCTG
ATCGTCGTGCGCGAGAGACTTACCTCGAGACTTTGGCTGCTGAGCGCAAGCAGCGTCAGTCACGTTTCGGTGCTCGGCTGAAGGTCTTTCTCCGCGTCAT
ACTACGTGGGTTGGTAGAAGGACGGTGTGACCTTGACATCTTGTTGGATCCATTCTTCGTGTACCGGCCCAGAACCGGTGAGGAGAAGGTATGGTATCCT
GGCCACGGCATTTCTCCCAGGTTTACCGACTTGATCGCCATCACCCACGCGACCGACATTGCTGAGCCATGGCGTATACAGCACCGATCGGCCATCCAGG
CGCATCCGGCATATGGAATCGGGCGTTTGGTCGGTAAGTTCACCCCCTTGGCCTCTCCGTGATCGTGTAGGTCGAACTTCATAACTTCGTAGTATCACTG
TCTTCCTTCTTCCTATCTCGTCTCCGTGGGGCCGGCCACAGATGATCCCCTTGCTTAATACTCACTTAATCCACATAAACCCCTTCCACCACCGCGTGCA
ACCGTCTTGCACCTGTATCCACCTCTAATCAGTAGCATTTGCTACTGATCGTCCTCCGCCACCTCGTGTGATTGCATCACCCCGAAACGACTGCGGCTGG
TGCGATTCCGCTCGAACTCATATAGCAGCGCCCCGCAGTTGAGATCAGCTTCGTCCACCCACGATGGGTCGGCATAGCCCTTCCAGTAGATTTGGTATTC
ACGATGGACCCGCCCGTATCTGGTTTTGCGCCCGGATCGGACGTCCACGATCTTCTCGACTTCGAATTCGTTATCACCCAAATCATTCTCCCAGCTATCT
TCTGGTAGAAGTGCTTCATCGAAATCAAAACGATTTTCTTCATGGGTGGTTAGCGTCGCGTTTGGTCGATCAGGAAAACTCTTCACCTTCTTCAACTTGG
AGACGTGCACGATCGGAAACAGGCGATACTCCGTGTGAGCTACTTCGAGCCGAGCAGCATAGCGACCGACCATCTCAATCACCCTGAATGGTCCATGCCA
CATATGCGCAAGCTTCCGGGCGTAGCCCTCCTTAACTCGGTCGAGGTACAACCACACTCGCGTCCCAGCTTCAATCTCGTGGGGTCTCACGCCTTCGTTG
TGTTGATCGGCTCTAGCTTGTATCGCGGCCTTGAGACGTTCGTTCACTTCCTTACGCGCTCGCTGGTATTGCTGTTGAATGTGATACCGCCACCTTCGCG
GCTCGTGGTCACACCTCCGCGTACTGCCGAGCGGCAACGACGCCTCTAACGTTGATCGTGGGTCCCACCCATGTACGAAATAGAATGGCGTGTCACCGCG
CACCCGATCGTGAGCGGTGTTGATCGCGAAGGTCAGCCTCTCGGCGTACTCATCCCAATCCTGCTGATTCGTATCTGCGACGTACATCTTCAAGGCGCGA
GTGAGTGTCTGCACCATCCTCTCTGCCGTGCCATTAGCATGTGGGCGGTACGCCATGGTAGCGCGCTGTCTCTGTTCCATTATCCGGTTGAATGCGCGGA
AGAAATCAGACATAAACCCGGGTTCCCGATCATGGCGGATTGCCTCACTGGCTCCAAAACGACGGAAGACACATTCTTCGTAGTTCTCTGCGATGGTCTG
TGCGGTCCGCGAAGCACTAGCCTTGGCGATCACATATCCCGAGAACAGATCTACCCACACCAACAGCTCCGTATTGCCCTTGAAAGACTTCGGCAGAGAC
GGTATATGGTCCATCGCAATAATCTGGAATGGGTACGTAGCCTGTACGTTACCTGGCGACTCACCCTGTACCACTGGGCGCCCTTTCCCAGTCTCACAAT
ACAAACATTCCCCCACGAATCTCTGGACACTCTTGAAAAGGCCTCGCCAGTGGAAGTGGGCCTTGATTCGCTGGTACGTACGGCCGATCCCCTGGTGTCC
GCCCTCCAAACTGGCATGATAATGATGGAGGAAATCTTGATGCAGGGTCGCGGGGACTACCAAACGCGCCATCGAGTCGCGGTTTTCGTCGGTCCGCGTT
ATGTTCCCGCAATAGAACAACAGATCGCCTTCGCCTACGTCGTAGTCTCCGGCGATCTTCGCGCACAGCCTCGCATCTTTGGAGCTAAGATCGGCAACGT
CTCCTCTCAGGTAAGCCTTCAGGTCCCCGATCCACTTTTCCTCGTTCTGTGCTCTGGCGATCCGCTCACTTCTCATGCGTTGTACGATCGTCTCTTGCAG
CGAAGCCAATACTTGGCGTGTCCTCCTCGCTGATCGCGTCACGGCGGTCACCTGGACAATAGAGTCATCGTTTGCCGTTTTCAGCCCTTCACCTAGTCGG
TTGATCGCGATCAGACCGTCGATCTCCCCTTCGGCCGACACAATCGCCCCTGCTTCTCGCTGTAAGGCAGTGCTTGCTAGCCGATCAGCGCTTTGGTTCC
AGTCGCGTTTCACGTGGAGTAGGTCGTGCGTCGGCCAGGCCTTCAGTTGTCCCATCGCCTTCTCGCGCAGCACCTGGAGTCCCGGCGCCTTACAGTCGAT
CTCCTCTCTCATTTGTCGGATGATCAGGTTGGAGTCTCCACAGATGATCACCCGCCCCTTGTCTTGGTCAGACAGGAGTTTGAAACCCAGTAGCAGACCG
CGGTATTCGGCTTCATTCACCGTTAGATCAACGGTGAACTCTGACGCAGCGGCTACTATGGACCATTCGGGTAACTGCCACACGATCGCGCTGTATGCTC
CCGCGCTCCTCTTGACACGTGCCGAGCCGTCGAAGCTTACGACAAGCAGTCTCTCGTCTAGACCCACTGTGGGTGGAAGCTTCGCGATTATCTGCTTCGG
TTCCTTAACTGGAGCTATGGCGATCAAGGCATCGTCCACCTTTGACCGCGGAGTGATACTGGCGGCGATCGCCCCCAGTATTTCGTCTTCTCCTTTGGTG
CACTTCCTGATCTCCATCACAGTAGAGCGGCCCAACGTCCTAGACGTCCTTGGAAACCCGTTGATTTCAAAAGCCAAGCGAGTGTCGAGTATCTTGACAG
AACTTTGATCGATCGGTTGGTCAGGGTGGTGTAACATACGTCCAGGATTCGAAGAAGTGCGAGCACTTCCTTGTCGACCATACCGTAATTCAACTCGTTC
GACTTCAACGTACGGCTCGTGAAGATCACTGGCCAGTACGTTCCTTCGTGCTCCTGCACCAGCGCAGCAGAGATCGCCCACTTATTCGCATATACGACGA
TCACCGGTTGGCGATCAGAATCGAAGTGCCGTAAGATCGGGGTAGTTACCAGCTTGGACTTCAGCAGATCGAATGCTGTCTTCGCACGGACCCAGCGGTC
GTTCGCTTTGCCTGTTTGATCGGCATTTCCGATGCGATTTATCTCGTGGAAGTCCACTTCACGAAGTTCGTACAAGACCGCCGCATACACCGCGAAGTCC
TCGATGAACCGACTATAATAGTTCAGGCTCCCGAGGAATGACTGCATCGATCGCAACGTTTTCGGGAATGGCAGCCTCTCCAGTGACTCGAGATCTTTCG
GCTTGGCCTCCAACCCTTCCGCAGACACTCGGTGACCAAGGTAATCGACCTTGCGGTATCCCCAGAAACTTTTAACCACGCTGATCGACAAGTTCCACCG
ATCACAGGCGTCAAGCAGTTTTTCTACTTTCTCGCAAACGTCGTCCCAACAGCCGGCAGTGATCAGGATATCATCGATGTATGATCGACGCCCCAGCACT
GAAGGTCTCGGTTCATCCTCGGGTTCGCCTTCCATGAACACGTCGATCAGCTGGGAAGGATCAGCGTTTGGATTGATTCGGAAATGTCCATACAGCGCGT
TGTCTATCAGTCGTTGGTAGATCTGTGGGGAATTCTTCAGGCCGAACGGCATACGCGTCCATTCGAAGAGGCCGAACGGCGTGACAAAGGCTGAGATCTT
CCGAGCGCGTTCTGTCATTGAGACTACCCAGAAGCCACTTGCCATATCAATGAACAGTACCAGAGCGCTTTGTCCAGATCCTCCAAAGATCGTTGACCAA
AGGCATGGGGTACACCATCAGGCGGGTGAGACTGTTGACCAAACGGTAGTCAATGCACAGCCGAATGTCGACACCGTTCTTCTTGATGATGATCACGATT
GGTGATGCCCACGGCGATGTCGAAGGTTCGATCATCTTTGCCGACAACAGACTTTTGATCAGCTCGGACAACTTCTCTCGGAACTGCGGAGCTACACGTC
TGACGCGTTGGGTCACAGGCGTTGCTTCTCCAAAATCGATATCACATACTGCTCCGTTCGCGGCTGGCGGCAGGGCATTTCCTTTGCCGATCAGCAAGTG
ACGGCGACGCCAGATGATTTGCCGCAGGCGATCAATCTCTTTTGGGGTATTCGCTTCCGAATCACCCACTTGGATGTCTTCGATCGAGACCTCGTCGGTT
GAGCTGGACACCTCGGGAAGGATTGCGATGTGGCCCTCTACGTCTTCAGCAAACAGATCGCCACCTTCGTGTTGGCATACCTCTTCATCCTCCGC