Description :
From Genome Similarity Track
Location :
Scaffold_2:424121- 429278
Transcript NameFunction/comments
Physo_127506hypothetical protein
Physo_127507unconventional myosin

Sequence
5157 bases(100 bases per row)
GTCGTTTCGCTCGTCTATCGTCCACCCTGCAGAGACGGGCAGCCCTAGTCGTCTTTCTCTGCATACAAACTTCAAGTCAAGATCGCCACCTAAATAGTGC
GCGCAGCGTCACACTCGGGTGACACCCAGCAGTGACAGACAGCATTTTGCAATCAACCAGGCAGGCAGGCAGATAGACAGACAGAGATGGCGTCGGCAGC
GGAGCTCATGGCCGAGAACGAGCGCATGGCGCGCGAGATCCACGCGCTGCTCAGCGCCAACACGACGCTGCAGAAGGAGATGCTGGCGCTCAACTCGGAG
CGCGACGACCTCGAGGCCTCGGGCAGCAAGAAGGTGCAGTCGCTGGCGCAGGAGCTCGAGTCCGTGGGCAAGGAGCTGGCCTCGCTGCGCTCGCAGTGCC
AGTCCATGACCGAGATCCTTGAGCGCGCGGACGCCGAGAACGACGTGGACGACGAGCCCGTGCCCGTACCGGTGAGCCGCAGACTCTCCACCGCCTTCAA
CCAGACTGTGCAGCGCGCGAGGGGCATGTCCATGCCTCGGCAGCGCCGCTCGTCCACCGTGGACATGGTCGCGCACGGGCTCACCAAGGCCGCCAGCTAC
ATGGGCAGCAGGCACAGCCCCGAGGACCATCGCCGACCCACAATGAGCAAGGACAGCCCGCCCATTTTGTCCAACTCCAAGCGCACGACGGACACCACCA
AGAGCCTCTTGTTCTCCACACACTCGCACTACGGCAACTTCCGACGACACAGCGGCTTCCGCAAGACTCGCGAGCCAGCAAGCGACCCGGTTGTCGTGCT
CTAGCAAGGCACCACCCACGTCAGCATGCTTCGACAACGGCAAGCTCCTGTATTTCACTATTTAACACCAAGAACCCCCGCACAACCGCTGTGGAACACC
ACACGTCGAGACCACCACAACCCGGACTTCGCTCCCCCTACGGTAGAGCAAAAGCTTCAGGGAAACAATTGTTAGTCGAGTTTAGTCAACTTCATGTGCT
GTACATTCGAGTCTACATGCACGTGGATATGTTTATTAGCATGAAAACTAGCACTACTTGAGGGAAAACACTCCCTGGCGCATCTTCGTCTACTTACAGC
GCGTTAGCCGACTTCTGGCGCGCCAGCTTCTGCGCCTTGAGCGAGGCCAGCGTGGGGCGCTCGAACTGGGACTTGCCGAGCTTACGGTTCACGTAGTACA
CGCGGCCTGTAGAGCGCGACACCTTGGCCTCCCAGCCGACGGGGAGAGAGACCTCCGGCAGCGCGTCCAGGTTGAACGACTCGCGCACGGGGCGGTCCGC
CGGCTTAGCCGCCGGCTTCACCTTTGCAGACTTCGAGGTCACGACGGTCGTCGATGCGCCGTTCTCGGACGAGGTCGTCGTCGTCGCCTCCTCAGGCTTG
CTGTTCGTGCGCTTGCTCCGAGAATCGTACATGCCCTTCACGACCGACATGCGTCCCTTCAGAGTCGACATGGCGCCCGTGACACCCACCTCCATGCTCT
TCACGATCGTGTTGCGCGTGGTGCTGCTGTTCGTGGGGCTATCCTCACCGTCAACCTCCGACACGTCGAAGCCATCGCCGTTGTCGCCCTTCTTATTCGA
GTTCCAGAAGCGCGAGCCCACGCTCATGCTCGGCATGCGCGGGAAGTGGCGCTCAGACATCCGCGCCTCCGAAGAACGGCGGTTGAGGTCGTCCGAGCCC
GTGAGCGAGTCCATCAGCACGGTCTCGCGCGGCTTCTTCTCCTTTTTGGAGCCAAGAGTGCGGAAGATCGACTTCTTCGGGATCGACTTCTTGTCGGGCA
CGACACCCTCAGCGTGAAGCTTGGCGATCTGCTCCGTCAGCTTCTTGTTTTCGGCCTCGAGCTGCGATATCTTCTTTTCCTTGTCACGCACGGTGTCCTG
CAGCTGGCGGACCTTGACGTGGTTGCCAGCAGACGAGAACTCCTTGTCGCTCTTGAACTTCTCGATCTCCGCCTTCAAGCCCTTCATCGTAACCTTCATC
TCCTCGTTCTTCTCGCGCAGCTTCTTGTTCTCACCCGTCAGGGTCTCGATCATGCCACCAGCGTCAGCCATAACCTCGCTCGAGGCAGCGGATGTGTCGG
CCGTCACTACACTACTACGACGCTGCAGCTGCGCATTCCGCTCCTGTTCCTCTTGCAAAGCTGCCTTGAGCTTCTGCAGCTGATAAGCCATGTCAGCCTC
ACGGCGTTTCTCCTCGAGGGCGGCCAGGTACTTGGGCCGCTGAATCGTCATACGAACCACGGCCTGCACACGGATAACCATCGCGCGCATCTTAACGTAG
CGGTGACGCTTGACGAAACCACGCACATACCGCTGGATGATGACAGCGTTGTGGTTGCTCTTGACATCGGCCGCCACCTTGCGGCCCTGAATGCCTCGCC
AGTGAGCTTGAGCCTTCACAAGGCCGTTCATGAACGTGTTGTATCTCCGCATGGCGATCACGCACCGGATCACTGACTGCAACTTGATGATCGCTTCCAG
TTGTCGGAGGTACTTGATACGCTGTGTGAAACCAAGCATGATGTTCTGCAGGTACGTGGCCTTGGCATCCAAGAACTTCTTGCGACGGTCCTCAAGCTCT
TCAAGGACACCAAGCTGGAAGTATACACGAGTCTTACCCATCTGGTACTGCACGGGCGTCTCAAGCTTCAGCTTGTCCATGAGCAGCTGGCACTTTTCCG
CCGCAGTCTCACCGCCACTTGGCACGAACAACCAGAACTTGTCCAGGATTTCAGTGTGCTGCAATCGGTTCGGGTACGCAGCGCGCGAGATACGAATGGC
TTCAATGACACCAGCGCAACGCAACTGGGACACCACCATGTTCTGGTCCATGACCGTCGCACTCTTGATCGGGTTCGGCTTAATGCAACGCACATAGTGC
ACACGCGTCGAGTTGATCGTAGCCATCAGTTCCGTCAGACTCTCCTTGAACTGGGTGCCGACAGTCGTGATGGACAGAGCACCTCCACGCTTCCGGCGTC
CTCCAGCCGCCTCAGTAGCAGCTTCCTTAGGCGCGGGCTTCGGTTCGAAGAGCTTGGCAATAAACGGCTTCGACGAACCACGCATGAGCTCGGAGAGATC
GGGAAGCAGCGAGTCCTTGTGCTTCTCCAGGAAACCCACCGAATCGTACATGACCGGAGCGGCGTAGTGCTTGATGAGGAACTCGGTGCGCGACGTGCGA
GGGAACTCAATGACGTGCGCCATGTCATCCTTGTGCAGGGAAGTAACCTTGGACATGAAGGACTCCTCGTTTCCCTTCGGACGCATCACTTCTTCGTTCA
GCAGCGAAATGATACCCATGCGCGACTCGATCACGGTCAGCACATCCTGGTTATCCGCGTACTCGATGTGGTCCCAAACAATGCCTTCCTCCTCGTACTC
GATCTGCACGGTCTTGAACACGTCCTGGGTGAACTTCTGCTGAAGCTTCTCGTTGGCGTAGTTAATGCAGAACTGCTCGAACGAGTTGTGCTTGAAGTGC
TCGAAACCGAAGATATCAAGCACACCCACGTGGTTGGCCATGTTCGCGTCGTCCGCGAGCGACTGGTTAATCGTGGCCACGAGCCAGTCGAACACATTGG
AGTAGATAGCCTTGGCAAGAGCGTCACGGCAGTCCATGGCCAGCTCCTTCTTAAGAGGCACGCTGTAGACATCGTTCACAGCGCGCATGGTACGCGAACA
CAGAGCCGTCTGAAGGGCCTCCCAGGTAACGCCAAGCATCTGAGTAGCAGAGTTAGCGCCAGTGTCGCCTTCAACGATCAGAGACTTCTCATCGTCAGAC
GGGTCGGACTGTAACTGCACCTCACCAAGGTGCAGCACACCAGCCAGCACCTCAAACAGCGGCCGCTGGTCATCGGGCGACAGGCCGACGAGCCCCAGCG
CCTCGCGCGTCTTGTTGAAGTGTTTGGCGTCCGAGAGTCCCTCGATCTTCTGCGCCGTGTTGTCGCCCGTGTACACGTAGTGCTTGCCCGCCTCCAACTG
CAGCTCGGGGGCAATGTCCGAGTCCAGCAGCTGGTAGAAGATGTGGTAGTTGCGCTCGGGCGCTTCGTGCTGGATGACACGCGTCTTCTCGAGCAGGTAC
GTGCGGCACTTGGCGCCGACGAGCGTGCCGTTCTTGTCGAACTGCAGCTGTGTGAACTTGCCGAATCGACTCGAGTTGTCGTTGCGCACCGTCTTGGCGT
TACCGAAGGACTCGAGCAGCGGGTTGACCTCGATAATCCTCTTGATGGTCGAGTTGTTGAGACCGCCGGCGATGGTGGCCAGGTGGTTCATGAGGATCTT
GGTGGTCTCCGTCTTACCGGCGCCGGACTCTCCGCTGACCAGGATGGACTGGTTGCGCTCCGAGCGACGCATGTTGTCGTAGGCCGCCACGGAGGTGGCG
TACACGTGCGGGGGCAGCTCCTCCTTGGGCTGGTTGAGGTAGCGCAGGTGCTGCTCCTCCGCGTAGAGGTCCGGGAGCCACTTGTACGGGTTCACGGCGA
TACAGATGTCGCCCGTGTACGTGTAGGGCAGCTCGCAGAGGAAGCGCTTCTTGACGTTGTACAGGATGGCGGCCTCGTGCAGGTAGTTGAGCGTGATCAT
GTCCTCGATGCCCTCGGGCCCGACGTTCTCGTTCTGGTAGGGCAGCGACTCGAGCTGGTGCACGGCCAGCAGCGCCTTGGTCTTCTTGGACAGCATGTCC
ACGCATCGCTCCTCGGTCTCGCCGTCGGGCAGCTCCACCTTGCAGTAGATGTTGCGCGTCTTGCCGTCGCCCGAGTTCTCGTCGCGCAGCACCTCGGCCG
CGAGCCACACGTGCGTCTCGTCCGGCACGAAGCACTTGGCGCCCACCACCATCTGCAGGTCGCTCATGGCTGCTGGCGTCTCCAAATCAGGCAGCGCTCG
CTCAAAGGCGGAGGTGCGCGGCTTGGGCGAAGGAAAGCGGAATGCCACGCAAGGGGGGCTCTCGCCGGCCAGGATACCGCGTGCCAAACCGGTAAGTGGA
GCCATTTTCTCATGCGGCAACTCATTTCACATGGACTTTGTATGGACTTCGAGTTGACAACCCTGATCCGGCAACCACATAGCCCGGACAAAGCGCAGCT
GGGCGCGAACAAAACCCCTGCGGCAACACCGGCTGGGATCGCCCGACGGCGCGCGAG