Description :
From Genome Similarity Track
Location :
Scaffold_30:424066- 431993
Transcript NameFunction/comments
Phyin_T30-4PITG_13738Putative uncharacterized protein
Phyin_T30-4PITG_13739Putative uncharacterized protein
Phyin_T30-4PITG_13740Putative uncharacterized protein

Sequence
7927 bases(100 bases per row)
ATCCCGAGTTCTCCGTCACTCTAGCGAACGATTGCTCCTCGTCCGCCTCTGTATGCTCCGCTTCAAGCTCAACACTCGTGTTACTCAGATTGAATTCCTC
CAGCGACTCAGCCAGCGCTTGCTCGTAAGGCGACGGCCACATCATCCCTTCTTGCTCTATAGAAAAGGCGTCTGCGTTCCTCTTAAAGATCGGAGACGCA
GGAGTCGGCGCACTCTGCTTGTGTTTATGTTTCCTCTGCTTAGCGCGTTTCTTAAGGTCATTGCGGAACGCATTAAGAGTCGACGACGAGAGGTGCGACG
TCAGATCGAGTTCGCAAATGTAGAAATCGCAGAACCGCGGCAAGTGACTCAAGAAGCGGTAACGTTTCTGTGCTTCTTCGTCCAGGACCACGTGCTCGAT
ATCCAGTATTTTCCCGTGAATACGTTCCGGTAACATGCGATAGCGATCCACCGGAAGCAGCTCCGAGCTCACAGACGAACTCTCAGTCCACGCAGTCAAC
TGAGTGTCTTCCCCATGTTCTTGATGTTCGTCCGAGTATTCCTTCATCAAACACTTCATGTTTAAAGGATGTAGAACCACGTACGTTCCATCCGCGATCT
GGTAGAACGAGTACGTGTCTCCACTGTCGCTGTCCTTGGGTGTGTTCTTCTTCCCAGTAGTCGAGTTGTTCGTACTGTTAGCTTGGCGATAAGTGCCGTG
ACTGAAGTCGTCACTCTTGGCCAAGCGTCCAGATGTGTTCCGCATGGCTTCTTCCACAAAAGGGAGGTTGTCTACGTCGCCACTACTGCGGAATTCCGTG
TCCATTGACTGGAGATCGCGCATCTCCGAGTACAAGAGTTCCCGTAAATATTCAAGCGTCGCCTCCAAGATACGTGAGTATATCGCATCAGCATCGTCCA
CATTCGGCAGTTTCCGAGAGCGTTTACGTGCAGCAAAAGCAGCAGCTTCGGGAGAAGACTGAGTGGCATGAGAAGACGCAGCATGTTCACTCTTGTCTTC
TGCTGTCGGGAGTACACGGAGCTGAGGGAACATGCTGGACTTGGGACGTTCCAAGAATTGGAAAGTGACGTCGCTGCTTACGTGGGGAGGGATTTGCAGT
TGTTGGAGCTGTACACTGCGTAAATGTCCCTTTTGAACAGACTCAAAGCACATGGGACAGCGACGCCAGTATTTCTCCGACATTGACAAATACCGTAGAA
TACACGGCCCAGCTACATACATATCAAAGAAATTAGCATACTGGAACTGACGATCACTCATGGAGAATTCGACATACCAGAAGACGTGGCCCACATTTGG
TGATTTTCGGTGCTCGAAACGTGTCCATGCAGATCGGACAAGTCTGGGGACTTCCGACGTCATACCACAGTAAAACCTGCTCGACCGATGACCCTGCACA
TTATAATCGACGAGTATGTTAGTTACAAGCGTTAATTGCAACGATAAATTAAGAAAGACATTACATTCAGTGAGAGCTTCAAGATCCCACGTCGGTACGA
TGGTATCACGGTCAAGTGGAGCTATCACGAATCGGTAGCTAATTGCACGCAAACACAGTATTAGCAAGCAAACACAGTGATTTAAATAGATGTATCAGCT
CTCAAACGCACTTGGCATGGAGGTACTCGCTCTGAGTGCGTGGTGTCGAGCTTTTCGTCTTCTTCTGGTGATGGTGCACCTGGCGCTCACGTTCAGGCAT
GGAGAAATTGAGCAGATGATTGGCGGATACTCCGTTACGCGTGACTCGCGCCTCGTAGTCCATGTTCTTCTTCTGCAGATAATAAACCACCCACGAATGA
GTGAGCTCAGCACGATCCACACGCGTCGACAGTTTTCACTGTACCTGCTCCCGACGGGGGCCACGACGGCTGGAGCCGCCATTACTGCTGTTGCGACTAC
TGTTATTTCTACTATTATCCACGTGACAGACGTTAGCGACCTCGTTCATCGTCAGTAGGTCTCGATTAATACTAGAAACGCACCTCATTATTGTGGGCAG
TAGGGTGGCAAATTAAATAGATATGGAGTTATGTACAATAGACACACGAGAAGGAGACGATGGGGAAGACGAAGCGAAGGACGAGAAGCGGGGTGAGGGG
CTGGGAAGGGCCAGCAAGGAATACGGCGTCGGCGAAGATGTCGTTCGATGCCGAAGACTGGTGAAGTGACGTGTGAGATTCAATCCTCGCGATTTCCACC
AATGGAAGAGCTTCAGTTAGTGCGTTTCGTGGTGTTTGATACACAAATCGAGATGGCGGAGACCAGGGAGGTGCTGCGCATGTACCGACGTATCCTCAAG
CTGGCGCAACGCTACCCAAGCATCAAGCGCGAGTCGATTATTCGTGACATTAAGACAGAATTCCATGCTAACAAAGACCTCACAGACGCGCAGAAGATCC
GTGAAGAGCTGGCGTCAGTACGCGCAGGAATTACAGAACTGTCCATGTATGCCAGTCTGCATCCATCGCTGCCCAACTGGAGCGTCGAGGTCGGGCGGGA
TGCGATTCATCCACCGCCGATGCATGGAGGTGTAAAGACAAAGGTTGTCAGTGCTGATAAGAAGGAGTGAGCACTTAATAAGCTTTAAAGTTAGCGTTGA
ATTATGTTGTTTCACTGTTTGCTGCTGCTTTGAATGGGTGGACAGAGTGTACAGCCTTCGCAGCATTGTTCACAAACAGGACCAAGCTGTGTCTGCGGGA
TAAGGATTAAGTCGCCCATTAGCTTAGACGTCGTCATGTTTAAGTACTGACTGATAGGACAGTCCTCGTCGGCGGCCTGAACAATTATAAGAGCATGCTT
GAGACGAAGGAATCCTGCAAGAGTCAATCATTTCAGACTCACCGCAATGACATGTGGAACACTTTCACTCTCGTCCTTGAAGTGACCAAACCAGTAGGTT
TGCATAGCGTTAGGTGGCCACTTGTGCGGGTTCGAAGACGTCGCGACGAGTGCCAGCACTTCCTGGAACATGATGCTGCGTCGGATCACGTCGTTGATCT
GTACAAGCTCGATGCGCACTCGCAGCTGAGTGAACGTCACCGTGGCAGCCTCCTTATCATCCAAGTTTAGCGTGCCCACAACAGGCAGCAACCCACCCTA
CAGCGTCACGGTTGATTAACCGTATAACGCGCTTTGTTAAGTACAGTAACTTCAACAGCGCACCTCAATGGTACCGACGACATACGAGTTCTGCTTCCTT
GGGTCGGATGGGAACGTAAACACACGGACCTTCACTCGAACCATCTTTAAAAAAAATAAACTTAAGAGTCACTCGAATATGTTTTTTTTTCGTTACTGAA
ACCAACTAACGTCAATGAATGGACCAAGTACAGAAGTGTACTCCGTTAAAGATAAAATACGTGCATTACTTAGAAGGAGTCTTTGGCGAGTTCCCATTTT
TCTTAAAAGTACACAATAGTGTTCACGTTTTTGCTGTCCACATAAATATTGAAACAGGACAGAAGTTGCTGCTTGATCCCTGTGCATGGTGTCGGCAAGA
AGACACTTGAGACGCTTCTGAATCTTCTCATCTGCTCCAGTCACGAACGTCCGCTCGAGTTCGTTCGCTTGTGTGTTGATGACTACTTAGATGTAGCACC
ATCCGGAGCGTTCGAAGGCAGTCGAAGGATCCGCTTTCTCCAGCTTGGACTGCGTCGACATGCCAAAGTGCTTCTCGGAAGGCACGTTGCCGGTCATCGG
GCGGGACATCACGTTCTTAAGCTGGTCGAGCATATTGTAGAGGTTGGTGGTTTGTAAATCGGAGAAAGCTTGGCTTCAGTCGATGGACGAGATGCTAACA
ACGACGCAAGTTTGGAACTGAGCAATGGCAGAACTTGCCATTGCGTGCATGCGCGGCGGAAACCAATCGTCGACGAGGCAACGAGAACCGCTTGTTTCAC
CTGTGTAATATTATAATTTGCGCACGTCACTGCGGGTTCTTCTCTTGCCAGCTGCTTTTGGCTTTGGTCATATCCGATACCCTGTATAAGACGATTCTTG
AAGCTGAGACTGAAATGCTGACGCCGCCTCGTCGATGTGTGGAATTCGACTCGCCGAGGTCACAGATCTCCACTGAGGCGCAGCACATTCAACGTCGCTG
CTTGCAACGCAATTCTAATAATACATGTAGGTGCGTTCTTTTAAAAGCAAGCTTCCAGAGAAATATGCTCCCAGATACGCGTTGGAATTCTGGTTTGTTT
CGGCAGCTTCAAGCACATTGTGTTTTTACGTGCATCTGAATAAGGCCGTTATGCTACATTCATCCAAATACGAGGCAATGGACGCCTTCCAAAAATGGAG
AAATCACCCGGCATAACTGCAGCAGGTATGTCGGGGCTTAACGACCTCTATGCCAACATATCTATTTCTTGGCTCACCAAAAATATAGTAAGAGAGGTTG
CTCTGGTCGATGTAGAGTGTCCCCTACGTGCGATTGCACTTGAGTTAGTTATTCATTTTACGTTCTGGGGCTTTTAAAACGGAACAAAAACTCAACAAAT
CTTTTTGGATTCCGCTTGAGGTTCGCCACTTTCCCTTTTTGGAAGCCATCGTGGGCAAGATGCGCGAGGAAGACGAAGACAGTGACGTTCTACTGCTATT
GTGTGATGAGTACTTGAGGCGCGAGGCAAACCTGGGCAGTGTCCGCCGTGAAATACACGAGGCCTTGATGGAGAGCACATGGCGAGCTGCAATGCGCACT
CGTCATTACTTGACGGTGGGCTGTTTGGATGCGCCCTGTGTTGCCGCGTGGATGGCTCTCTACAGGAACGGCGTGGACTCAAACTTTCTGAATGCTACTA
GTCTGACCAGGTACGTTACGGATGTCCGGTGTGTTATCGGGGGGGGGAGATCTAATTATATACCGTCACGTACTACACAGAGCTGCATTCAAGCACTTAC
TGCGCCGGTTTGCGCGCTACTACTACATCCCTCCAGCCAGAAGCAGAGGACGGCCGCCAAAATTGCGCTACCATCATCAGGCTCTAGGTCTCGTTCTCTG
CTTCTACGTCGGGTCGATGGAAAACGGAACGCTGAGCATGTTGTTTGGGGTGCCTCCGAGCACTTTATCTCGGACGCTGCGCAAAGCCGAAGAGGCGCTG
TCGTGTGCACTTCGGGATTTCTCCCCAGCGCGGATTTCATGGCCGTCACCTTCTCGCCAGAGAGAGCTTGCCAGCTTGGTGAACGCACGCGAGCCGTTGC
TGGAGCATACGTTCGGGTTTATCGATGGAAAGAACTTCCGTGTAAGTACGACGTTGGATGCCTTGTAATATCTCTTGACTTGTAACGTGATGCTGTTACT
ATTTACGTTTGCAGGTGCAGCAGCCTTCTAGCTCCGACCTTCAAAACGCAATGTACAATGGATGGCTACACTCGGTTCTAGTTACGGGTACTATTTGTTT
TGCCGCAGACGGCTGCATTATCTGGGCCAAGCATAATTGCCCTGGATCCTGGAACGATTCAGATACGTCTCTTGGTTTCCGCATGAAACTTCTGGATCCT
GTGTATTGCCCTGACGAACGCATGAACGTTGTGTCAGACTCCGCCTTCCCGTGCTCCACGGCAATGACAGGCAGGATCCTGACTCCGCTGAAAGACGGAG
ATCTCGAGAGAATTGAACCGTCGCTTCGGAGTTCAGCGCGGACGCTGCACAACGCCATCACTTCGGTGAGGCAGGCTGCAGAGTGGGGAATGGGCAGCGT
GCAGAAGGTCTATAGTCGCCTTAATGTGCCGCTACCCTACGATCCGAATCTCCGTGGTCTAAGGCTCAACAACATATTCCGTATGGCGAATTACCGCGTG
CGGGCGGTGGGTATCTCGGAGATACGAACAACGTTTATGGGAGCGATGGAGATGACGTTGTAGCTCCAGCTGGGTGGTGGGGATTGGGAGAACTTGGATA
TGTTCATTTGCATGACTAGCTTTTACCCAAGAACGAATACAAGTGCGGTTATCGGACATTTTCAGCCGTGTCGGTGGTTGCTTGGCTCGCTACGGAGGGC
TGGTTTCAAAATGCAACGCTACAAAATACACTTCCTCCCTCTCGGTCCATTCCCGACGGGTGCTTTCGGTTCTGCGAATCTGATCTCTTCACTCCTTCTT
CACCAGAGCACTGATGAAGAACATTAGTTCCTGGGAGTGCGCACGGGCCTCCTCTTTATCGCGGCGAGCTCGTTCCTCCGTCTCCAGCTTCTCTTGCCGA
TGGCGTTCTTCGGCCTCCAGCTTCTCGGCGCGGTAACGCGCCTCGCGCGCCATGGCTTCATCGCGGCGACGCTGCTCTTCTTCCGCCCGGCGAGCTTCAC
CCCTACGTTCGCTATCCTCACGCATGAGGATCATCAGCTCGACAATATTTGTACCCATGGCCCCGGACGAGCTTTCTAGGTCACCCAAGCGCTTCTTCAG
CTGTGTGGCCGCCTTGATAGCCTTCGCCCGCTTCACCTTGGCGTAACTCGCCTCGTGAAGGTCTTGGTCGTCGTCGGCATCTCGCTTGCGGCCAATGGTT
CCACGAAACTCGGCAAGATTGCCCCCTCCAAGGCGGTTGGAGTAGCTAAGATAGCGCGTCGATTCCGCAGCACGGCGCGAACGATCGGCTGAGCTCTGCT
CTTCGAGGACCGCAGTTGAGGTTGTGTTTTGCGATTGACTGGGCTTCGGTAGACCAGCAGAGCGAAGCTCGCGTTGAGTGGATCGGTCGGGCCCAGATGA
TGACCTCGGAGTGCTGGCGAATGCCTCCAACCCGTCATGAACAGCGGCAGACTCGAGGATCTCGGCGAAGCTACTGGCTGCGTCCGTGATGTTGATACCC
GGCTCGTTGGGCAAACTGGGCAAACTGCTGGATCCCTCACGGTGAGGAGTATCGGTGTTGGAGAGGCTTCCACGGGCAGAGTCAGTCGTGTTGCTCACTG
AGCTGGAGTCGTTGCCGATCCCGTCGTCTCCATCAAAGTTAAAGGAGAAATCTGGGTGCTGCTCACCCTCTTTCTCCTGTTGGTCATCTACGTCGGCTCC
GTCGTCCATCTCCTCAACACTCGCCTTATCGTCGATACTTTGCTTGAGCTGTTTAGCTTCCTTCACGTGGGGAGGCATGTCAGCGACTCCCGTGGGCTTA
CGGATACTGTACAGCATCTTGAACTTGCGCCGGAGACTCTCGTAGTCGCGCTCGCCAATGCCCCGACCGCGGTTCGAGTTGTACATGCTGGCAAGACGCT
CCCATTCGTCCTTACCAAGCGGCAAGAACTTAGCAACAAGACTCAGCAGGCGTTGCACCTCCGTGAACTTGTAGTTGGTGGATCCAGTTAGTTTAGCCAT
CTATCATGAATTAAACAGCAATTGATGAGACGTCAGTACGAAGTAGAGGAAGCAATGAAGAGATTGGCAGCGTACCGGGACGAAGTGAGCGCAAGAGGCG
ATCGAAGACAAACACTTGGTCGGGAACGGGGCTTGGACTTGCTCGGATGGGAGTAAAACCAAAAATGAGACTTCGGGGACGTCGTTCGCTGTGTCTGGAG
GCCGCACTGTGGCAGCGCGCCCTAGGACGCGTGAGTAGCTAGCTATCACAAGGGTTCGCGCCGAAACGAGCGCGCGCTAACAAAGATCTACGAGCTCACG
AACCATACAGTATGGAGTCGCGTTTTGGCGCGAAACCCGTGCTTGCACAGCTTCAACGTTGACGCTAAGCTTCGATATGTGAGGGAACCAGCTTTACTTC
AACGTCCAAGTAGCATATCGAAGATGAGCATTTGTCTTTACAGTAGGTTTGTATGCACGGGCTACCTACACTCATCACGTCTCCTGACAGCACGTCGGCT
ACGGATCGCTCTGGTCCTGGATCTCACGATGACGACAGGAGGCGAGACCACAGCGGCACACGAACCAAAGATCACCGCCATAGTCAACGGTGATCTCCTC
TCCTTCACGTACGATCTCTGTAGTGGC