Description :
From Genome Similarity Track
Location :
Scaffold_1602:4240- 5440
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1602-fgenesh-gene-0.2Cysteine protease family C01A

Sequence
1200 bases(100 bases per row)
GCGGTGCGGCGACGATTCGAAACGATCACACCGATCACGGTCAGCACAATTGTCGCAATGGACACGACAACGGCTGCAGCGATCCAGACACCTGGTGCAA
ATCCCAAAAACAACCTGTCACCGCCACCATCGACAACAGACTTCACGGCTCCGGCGGCGGCGCCGAGAGGAATGACTGGGAACACGTTCACGCCGCAGTT
GATCTTCGAATCCATCTTGAGCTTCAGGAATCCCTTGTCGCCCCACTGCTGCGAGTACGAGTTCTTGAGGATCCAGTAATCCGTTGATCCATCGGTGCCG
TAGCCGACAAGCACGACGGCGTGGTCAATCTCCGACGAGTCCGTAAAATCGCCGCTGTTGGGGCACTCGTAGATACCGCCCTTGTAGTCCTTAAAGTTGC
TTCCGGAGTTGATGGCGACCGAGATCGGTTGTTGCTGCAGCGCAATCTTCAAAAGTTCTGTGGCATCCGTCGAGTTGTCGCACTTCTTACCCACGACTTG
CTCCCAGTTGTTAATGCTCGCGGCGGCCTTCGTTGAATCGTTCTCGCACGTCGCATTGGCCGACGACGTCGATGGCGCCTTGGTGGTCGTCGTCTTGAAC
GGGTTCAGCGTCACAACATCCACTTCCTTGTACGGCATGTCCAGCTCCGTCATCAAACTGAGGTGCAGCGCCGCGGCGTCTTGGAACGCACCGTGAGTCA
TACCACCATCGCAGGCATTATTCTGCGAACCCCACTTCATTTCTGGTTGCAGCCACGTCGCTCCCTTGGCACCGGACGCCGCCCAGCAGTACTCAAAGGT
CGCCGTCATATTACGCTTACTGCAGTCGAGGAACTGTTGCGGCGAGAGTGCCTGTGGCGCGTTTCCAGAGTTCACTGCAACGGCAGTCTCGATAGCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCATTTGTTTTGACTCTTGACCGTCGTGCAAATGTTCCTCTTGAGTGGGTTGTCCGTC
GAGCACCAGTTCAGCGTCGACGGCAGCGTGACCGCCAAACGTCGAGATGCCTCCGGTTTCACTTGCATGGCCTCCTCAGCTTCTTCAAGGCGACGTCGCA
TCTGCGCATGCACCTCCTGACGCACAAACTGCTTGGCCGTGAGCTTGCGGTTCCCATCTAGGTACAGGTGACGGGCGTTCACGCCGATCTTGTACGTGAA