Description :
From Genome Similarity Track
Location :
Scaffold_80:424- 5927
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_80-fgenesh-gene-0.0NADPH:adrenodoxin oxidoreductase
Pytir_DAOMBR486maker-pir_contig_80-snap-gene-0.31Kinesin

Sequence
5503 bases(100 bases per row)
GACAGGACCAAGAGTTGAACCGCTGTCAAACCGCTTTGCTGCAGCCTCAATTCTGTTAAATTTTGTTTTTATTGAGTGAAAAGCTTGAACAAAGTATCCA
TTATTGAAGGCAAATATCGATCGAATGCTCTCGAAGGTTCTAAGATCGATATGTGATGTAGAAATTATGGTCGCTTAAGTACAAAAGTGAATGAAATGAC
TACCAAGAGTAGCGGACTACACAAGACAAGGTGAGCCAAATTGAGATTAAACAATGGTGGAGGATATTAATTATTTTGGTATGAAGATTTATGAATAGAG
TAATATAACTAAAAAATTTTTAGCAAGAATTGCAGGTTTGCAGTTTCTATTGATTCTTAGATAATCCTCAAGAGATGGTGATGCGAGATCAAACAAGGCG
CTAATTTAATTGCCGCCGTGTACCGCCAGTTGCAGTTCGCGAAAAACATGCCTATGAGAACGTGCTTTTCACTTGGCTGAGACAAATCATGTGAAATTGT
TTATATCAATATATCCCCACAATACCTAAAGCATTCTACGAACTCTCGCACATAGCTCATAAAACTATTAGCACCTCTTCTTCTCTTCTTAAGTCTACAG
CTTTTGAAACCAGACACAATGAACCTTTTCACACCATTTGCATGATCTCCGTACACACCACTGCGACGCTGGACATACTTTATTTGCAAGCTAATATCAT
GGCGCTTTCCCTCAATCAATCCCAGAAGTGGGTCGCCCATCCATCGAGTACTGTGGCTCACCAATAGGTGAAGCACTGCAGCGTGGATAGCTGAAACGGT
AGAGGAGGATGTATATGACTTCGAGTCTGTGAAGCTTGTCGCGACTCGGTGTAATGATGTAGTCTAGAAGCAAACAGCGCTGTCAAAATGAATCAAATGC
ACGCCAGTACAGGCAAAACTTACGACTTCATAGACTAGTCTGGTTGGTAGTTTTTTCTGCGGTCACAGCGTGCCTGCAAATCGTGAAGTTAGGTTTCCAG
AGATTTCCCACACAGTGAAAGGCACAATTTGTGGGAATAGAAACTGACTCCTGCGAAATCTGTCAGAGGAAACTTTGCATTAAAGTGCGAACATTTTTCG
TCACATACATGTGGTGTTATTCTGCATTGTACAATATTTTTGAAGTGCAGATCATCACTCCTGGTGATGCACGAACGTAACGGGGCAACAGGTTCGCCGA
CGATGTCTGACCGAAAACTAACATGATTGACATCCATCATTTCATTTTCCGCATTTTTGTTTGGTACCGATTGCAACAACAATGATGATGATGAAGCGGA
TCGCCCGCGGCCGCTCCACGGCGCTGCTGCTGCGTCGCANNNNNNNNNNNNNNACCACACCCGCAGCAGCAGCGTCCTCCGCTGTCTCGGCGCCATGGAC
GCGCACGTTCTCCACCGCCGACATCCCTGAGCAGATCCGCGTGTGCGTCGTGGGCTCCGGTCCCGCGGGCTTCTACGCAACCAAATACCTGCTCAAGGAG
CACGCGCGTGTGCACGTCGACATGCTGGAGGCGTTGCCGACGCCCTACGGCCTCGTGCGCTCTGGTGTCGCGCCGGACCACCCAGAGGTCAAGTCCGTCA
TGAACGACTTTGAGAAAGTCGCGGCGGACGAGCGCTTCGCGTTTCTCGGCAACGTCAAAGTCGGCGACGATGTCTTCCTCCAGGAGCTCAAGGAGAACTA
CCACGCGATTGTGTTGGCGTACGGCGCAGCAGGCGATCGAGAGCTGGGCATCCCGGGCGAGCACCTGGCAGGGGTGTTGAGTGCGCGCGCGTTTGTGAAC
TGGTACAACGGCCACCCGCAGTTTCGGGACCTCCAGGTGGACCTCTCGGCCGAGACCGCGGTGATCTTTGGACAGGGCAACGTCGCTGTCGACTGCGCGC
GCATCCTGACCAAGTCTGTGGACGAATTGGCGACTACAGACATCTCGCAGCACGCCGTGGACGCGCTTCGCAATAGGTGTGTACTCTGGTTGAGTCTCTC
GAGTTTGATCAGTGTTGCCAAGTATTTTACTCACTCGCTCCTTTGTGATAATACTCATGCAGCAACATCAAGAAGGTGTACCTGGTTGGTCGCCGCGGTA
GCGCGCAGGCGGCGTTCACGATGAAGGAGATCCGCGAGCTGACCAAGCTCTCGGGCGTCTCGTGTGTCGTGGACCCTGAGGAGCTAAAGGCGAGTCTGAC
GAACGCCTCACAGCAGGAGATCAACGAGCAACGAGCCAAGAAGCGCATGAACGAGCTACTTAGTAAGTGGGATTGGTGACTGAGCTCTTCACAATGTTGG
CACTGGTGTGCAGGTGCTTATAGTCTGTCAATCGTCCCTTTTACACTGGTTTACAGCCAAGATCTCGGGTGATTTCGGAAAGGACGTCGCTGGGAACAAG
GAAGTGCAGATCAAGTTCCTCTCTGCGCCAGTGGAGCTCGTCGCGGACCCTGAAAGCCCAGAGAGAGTCGGGAGCGTGCGTGTTGAGAAGACTCGGTTGC
AGGGCGACGCGAACCGCCAGCGAGCTGTGGGTACAGGTGTGTTTGAAGAGATCCCCAGCGGGCTCGTGCTGCGCAGCATCGGGTACAAGTCGCACCAGCT
GGAGGACGCGCCATTCGACTCGCAGCGCAACGTTCTCGCAAACGTCCAGGGCCGCCTTATGAACAAGAGCACTGATGATGGAGAAGAGCAAGTCGTGGGT
CTGTACTGCACTGGGTGGGTGAAGCGCGGTCCGTCCGGTATCATCGGCTCGAACATTGTCGATGCACGAGAGACCGTCACAAGCATTATCGAAGACATCG
AGAGTGGCAAGTTGCTGAAGCCTGTCAGTGCATGCACCAGCGGCAGTGGCTTGGAGACCATCAAGAAGATCATTTTGGCGAGAAAGCCCGAGAAGCAGCT
CGTGACCTGGGAGAACTACGAGCGCCTCAGTGATGAAGAGACAAAGCGCGGCGAAGCGCTGGGCAAGCCCCGTGAAAAGGTCACTTCGGTCGACGAGATG
CTGCGGATCATCGCTGGAAAGAACTGAGCTGAAGTGGTGGTGGTGAGTAGACAGATTGATGCGAGTCACGGAAAATAGGGAAGCTGGTGGTTTTGTATTT
ACATTTGGCTAGAGACAGAGCCGTGTTGAGCACTAGAAGAAGAAATCAATACCAAAACTGGAATAGACTGCATGCAACAGTGGCTAGTGACCGCCGGTGA
TAGATTTNNNNNNNNNNNNNNNNNNNNNCGCTGGGTTTGTCTCGTCAGTGCGATGTTCGCGGCTCTCAGCGCTTTGTTCTTCTTGCGCTAGCAGGACGAG
CACAAGGTTGTCAGCGACAGTTTCTCAGTTTTCACACTTACGAGACTCAATCGAATCTATACCTCTTCATCCAGCAGCGCTTTAATACGACCAAGCTCAG
CTGAGTCAGAACCGTCTCGTGACGTTGACGGACACGATCTGGTCGCTGCTGCTGCTGCTGATAGAGACTCCTGCCGATGCTCAAAGATGATTTCATCAAC
CACCTCGCAGTTGTTTGCGGTCGGGTGAGCAATCGTTTGGTTCACTCGGTCACGGAGTACGGACGGATAGTTTGTCGTCTTGGAACGGCGCACTGGCGCG
GAACCTGGTCGAACCATCTTGCTGTCGTCGTGAGGATGCATACTACTGGCGGCGTTTGTTCGATCCAGGTATTGAAGATGTCGCGTCGTATCGGTGGCAA
CCTGGTTTATGGCAGCGCGAAACGTCAGTCTCTGTCTCAAGCTACTAGAACTGGTGGTGCTAGCTAAGTCGGCTTACCAGCGCTTTTAGATGCCGGAGCT
TCGTGGAGTCAGCGAGGATGTTCTTCGGAGCCATCGCACCGCTGGTAGATTCAGTAGGCGGTCAGTAAGAAAGTAGACTCCACTATGCCAATGAGCTATC
ATATGGAGTGCGTACCGTTGTCCATTGTTGCCGAGCACGCTGAGAAGCCGACCGACGTACGTGTATAGCTCTAGGCAGTCTTCTCGCAAGTTCTACAACA
CAAGTCAAAACCGTCCTGAGAGGTCAAACATGCCGCTCCAAGTACAAAGTGAGAATAAACACACTGGAGGTCTAGCGTACGTCGACGGTGCGAGCTGTGG
AGGTATGCAGTTGCTGAAGTTTCTCGTTCGCAGTGTCCAGGTCGGTGCTCTTCTTCTTCAGGATCTGATCGAACTGATATTTGAAATCACACGCAAAGTC
AAGAAATGTGTGAGAGGAGGGTCAGTATGGCGATATCTGAAGAACCAGCCGACAAAAAGGACAGAAGCAAGTGCGCACATGCTGTCGAATGAGCGCGATC
TCGCCTTCTTTCGAGCTCTGGAGAGCTGCGACGCGCTGGAGGAGTTTCTTTTTCAGCACGAAAACCCGAGCAGTGCAGTAAATCGTCAGACCACTTAGGT
AAAAAATAGTTCAAGACTTCAGGGCAAAGGATCCCCAAGTCAAGCGAAGTGTTCGTTCTGGTACCTGCTCGCTTTTGTTCTCGCGCTTCTTGCTCTCGTC
TCGTTCTGTGGTATCTGCTCGGACGCTGCTGATCGATACTGACCGATGCCGCATCGTCTGCTGCTGCTCCCATTGCTCCTGTGAGTGCGGATTCCTGCTC
AGCAACTCCCGGATCTCGGTGCAATGTTTCATCTCCTCGGACGCCAGTGCACGCTCGTACTCCTTCGTCTTTTGCACCAGACTCTCTTCGAGAGTGGCGA
TGCGGCGCCGCTGATCGTTCATGGCTTTCCGCGACTCTTCTTTCTCTTTCTTTGCCTCACTCTGCACGTTTTTGGGAGGGGAAATGGGTTTTATGCGTGA
GTGAAGATTTGGTGGGAAATGGGTTTCTTGAGTCAAATTTGACGGTGTCCGAACGTACCACGACGACCATGAAGTTGTTCTTCGCATTCGCGTACTTTTG
CCGGAGGTGGTCGCGGTCTTTCTTGGAGATCTCTGTCAATAAGTCACCACCATCACCGCCATGAGTCGCTGCTAGCCAGTATCTCCGCTTGGAGTACATA
GCAGATCTCGATCTTACCGTTCGCTCGTCGCGTGGTCTGCATGCGAGACTGATTCGCCGCTTTCCGAGTAGGCGAGAGCGCGAGACCGCCACTCTCAGCA
TCACAACCCTCAAGTTTAGCATCCGAGAACACTGACCGGAGCACAAGTCCGTCCTTTAGAAGTGAAAATACGACAGAGTCAATTTCGTTAAAAAAAATCA
CAAAGTTCTCACAGATAGGCTTATGGTGAATCGAGATGCCAATCGCACCGCAAACTTGATTTCCCCGCTCTCCGTGATCTCCTCCGCGTCAAATCCGAGT
TCGTTCAGCGTCGCGACGAATTTGCTGTTATAGTCGGAGCGCAGTCCTTCGACCTGGCGCCGCAGGATCGAGAGCTCCTCCTGGAGCTTGCGGATGCGGC
GGTCCTTGTCTGCGACCGAGCCGTTAATGTGATTCACACGAGGCTGTTAAAGCACAAATTTGAAACTGAGGTCAGCGTTAGGCTGGCGAAAGAAAGGATA
TGT