Description :
From Genome Similarity Track
Location :
Scaffold_1333:424- 5048
Transcript NameFunction/comments
g15080.t1OWZ00383.1 hypothetical protein PHMEG_00028436 [Phytophthora megakarya
g15081.t1hypothetical protein
g15082.t1hypothetical protein

Sequence
4624 bases(100 bases per row)
ACAATAAGGGATACATTCAGGTGACCACTCCACAGGGTGGTCCACATTCATAACAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGA
GTCATTCAATAGATAGGGGTTCTGCCAGCTATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTAGGAGGAAACCCCATTTACAATCAATACAGTTC
TCATTTGGCACCAAAGCTATCGTTCGGTTCCTTTATCTAGGTTTAAGTATACTTGCGGATACAAGTATACTGAACTTAAGTTAAATACACCTACGCTTCC
TCATACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCACTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACTAACACGT
TCGTGTGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCCGCAACGCATGTTGCGCGTGCAGAC
TGCCCCCACCTGTCGGAGCCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCAGTTGGGAAGCGGCGGTAGCAACGATGTTGCGAACGCTATCACCGA
CGGAGCAACACGGTGTGGGCTCTGGGTTTCGATGCGTGGAAGGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCAGCCACACCGCGCGTG
GAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGGGAACCTCTCCTCCGTTGGCTAGTCGAGGTCGACACTGCCATTACGGCTCGACGTA
TCGTCGATCCGTTGTCGAAGGTTGCGTTCGCCATATCATGTCTTGGCGGACGAGCAAGGAGTTAGGCGTACGGACGCCGACTCACAGACCCTACGTGCTT
TAGCACGTACGAGGATTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTTCTTCGATCTGCAACAGGGC
AAGCATGACGTGCATGCTTACGCCCAAAGGGCACGGTAACTTGGTCCTCGGAACATCGTGACCAACGCGATTGAACGAGGGCGACAAACGGTCGCTCACG
TCATAGGAATAGGCCTTAGAGATGGGGCCTGTAGAAGACCTTATCTCTTCCGAAGTATCCAAATACTCCTCGAGGCTGCAATTGCGCTCGCAATGCAAGA
AGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTC
TCGAGTGCGACGGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTTCGCTGCGGAAACATCGGTCACTACGCCCGCGAGTGCACAG
CACCTGTGCACGCGGCGAGGAGCCGTCGTGGTGATACTGGGTATCGTCACGGGCAATAAAAAAACTAGAGGGACCAGCAGGTGCGGGGCGCCCTGCTGGT
GATGCGGTCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACC
TTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTTTTCGTGCTCTAGTGGACTGTGGAGAGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAG
GCTTGACTTCGAGGAGGTGGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAAAAGCGTATCGTACGCGTACGC
TTCTCGTATCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTCGAACTGGACGATAAGTTCGATATGGTGTTGAGCATGCCGTGGCTTGCACGGCATG
ATCCGGTGATCGACTGGACGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACG
TGGTGCATGCGGCCCTCCACTAGATACAGCGCGGAATGCGGCTGTCTCCGATCACTCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGAAGAAGATGT
GAAACGAATCAGCAGGGCCTGATTCGATCGGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTCGTGTCGACAGGTAATGTCGACACACAATTTG
TCGAAAGACACTCCGCCGTTAGGCGTCGAGGTAAAGAAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACC
AGAAATGTTTGCGATCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCGGCGGGTAGAACCCGCCGGC
GAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAGGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAGCTGCG
CAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTATGCCGGGTAGACACAGGAGTTGGAGACAACCGTCGAGACATTGAGTGTCTTGACGCGTACG
AGTATTGGTCTCCAATACAAGAAGATGAGACTGGAGAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTC
GCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGGTGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGG
CGCGGACACCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTCTACAAGGTCTTGCGTGAGTAC
AAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTTATCTCGTGCCGGGAACGAAGTATTGCGTCACGC
GACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAG
CGCGCCTACGTTCTGTGTCAAGAAGCCACAGGGCGGGTAGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCACGGGACGCCTGA
TTACTCGAAAAGATGTGGTATTATCGTATTTTGCGATGATCCTCGAGTTACTATTTCTCAGTATTCTGAATCTGAGAGAACGGGGTTCTATTCAATCGAT
CCTTCGATGCGTGAGAGGTTATATCCTCTCCACGGCGGTACGGCACTACCGAGCGGCATTTGCTCTGGATGTTTGGGCTCGTTGATGCGCAGGGGGCTGA
AAGAAACGCCCCAGCGACTGTTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTTGCACCGAGCTATTTCGACGACGTGTTCATTCACA
GCCGGGCTGTGAATGGGAGACCGGATGTGGAGATACATACAGATCATCTCCGCAAGTTGCTCGAGCTCATGCGAAAACACAAGCTCTATGCAAACCTGAA
GAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTTGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAA
TGGCCTACGCCTTCAAATGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGAAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGC
TGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTTGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCAATCTT
GGCGGTGGCCGACCAAGATTCGCCCATTCCACGTTGTGATGTGATGCATTCGATTTGCGCGATCGGCTATGTGCGCATCTTGATTGCAAACTCCGATCAC
GAAGGCCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATG
CACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATCCGTGGTCTACACCGACCGCGCATCGTTGCGTACGGCGATTATGTCGCCGCACATATC
CCAAAGAATGGCACGGTGGCTGTCATTCTTTACTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGT
CGACCAGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCGTCCTTGTTGGACGACGTGAAGGCCGCAT
TCGCACATGATGCGGATGCGAAGCAGTTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACATTCGTGCTCGTGTACA
CCGTTATCGTGTACACAATGGTCTACTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATC
ACGTACGAGTACCACGATGCCCCG