Description :
From Genome Similarity Track
Location :
Scaffold_1529:424- 3913
Sequence
3489 bases(100 bases per row)
TTTGAGTGATGACGACATTGCCCACAACGTCGACTGCGCATCCCAACCATGAACGAGGTAGAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTA
ATAGCAAATACTAGCTCCTCCGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGAGCCCATCACCGACTTCACCGAGCGTT
CCTGCTGTCCATTAGCCTGTGGCCGATAGCTCAAAGTCGCTCGTGATCTTGACTGCATCATCTCTGCGAACGCTTGGAACACCTCGCTCATGAAACGTGG
GTCACGGTCGTGTCTTATCAGTGATGGGGCTCCGAACCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCGGTGCAGTCGTATCTGACATAGCC
TTGGCAATAACGAATCCCGTGAGCGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACAAAATCCATCGAGACGA
TCTGGAAAGGTCGTTCGGCTAGAACGTTGCCAGGCGAGTATCCACGAAGCTGCGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGTTT
CTCTACGTCGGCGTACAAGCCGATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAG
TTCTGCAGGACCTCTCGAATCAGCGTTGTCGGTACCACAAGCCGCAGCTTGGTCTCTTCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAAGATAGT
GAAGCACGCCGTCTTCTGATAACACGAACCGGTCAGCGTACTTCCAGGCATCTCGAGCTTCTTTGTAACTCAGCTCTTGTGCTTGGCCCTGAAGCACCTT
CTTGATGTTAAACCACTTCTGCTCCTCGTCTTGTGCCACTAGTATCCGTCTGCGTCGTTCCCGCTGTATCGCTACTGGGTCAACATCTTCCGCATCGGAA
AATGCCGCTGGTACAGTCTTGTGAGGATGGTCTGGCAAATCCTCGCCGATTGAAGCTTTGGTGGACGTCTCTCGTCGTTCTTCATGCTGTTCTTGAGCTT
TTGAGACCCCCTCCGAGTGTTCATCTGCAAACCTGACGCGTTTCTTGATATTCGTCTGTCGCCTAGTCATCACTGCCATATTACCATAATCGCACTCTGG
TGAGCTGTAATCAACCACGAAATTTTCGAAAGTTTTCCACTTTGAAGACTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTCCACGTGACGAAACA
TCTACCGAGTCTTCATCCGGTTCGTAGATCAATTCCTGGATGCGATTCAGCGATGCCAATTCCGACTTGCGAGTTTCAGCCAAGATGACACGACTGACCT
TTGATCCCAGCGCTTCAGTGGCTAATGAATCCGCGGCAGCGTTGTATTCTCGTACGATGGGAAGATATTTGACGGATCGAAGCTTGGCCGCGAGTTCCTT
GTGAGTATTCATCAGCGCTAGCAAAGTTTTCTTCCTGAAGGCAATCACCCTAAGTGATTGCCGAATCGCGAGCCTTGAGTCACCAACGATGACTAAATCC
TCGGCACCGTGTGCAATAGCAGCCTTGACACCGTTAATCATTCCTGTGTACTCTGTATCATTCACCGTGGTGGCCGAGAGGTAAGCGTTCGCAGCAATCA
CCATCTTCCACTCAGGAAGGCTCCACAACATCCATGAACAACTCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCATCAAAAGACACGACGAATCC
ACTATAATGACGGGGAAGCCTGGCGTACAGTAACGCTGGGTCCATCCGAATAGTCGGAGAACCCTTGTTTGGAGGTGCCACCGGCGCGAGTGAGTCTTCC
AAGTCGACGAAGATCGTGATGCTTGACTGCAGTAGTTGCGCGAAAGCGACATTCTTTTCCTTCACGCGCTGCACCTGCAAGTGCCACTGCGATAGCAGCA
CTGCGAACTGGACTGCGCGTCCGAAGAGAGACTTCGACTTATGTACCCACTCTAACGACAAAAATCGTGTATAGACATGTAGCGTCTTCCTGCCAGCTGG
ACGTAACAGATCTTCAACAGCAAAAGTAACGCCAAAACTTCCTTCTCGGCAGGATGGTAGTTCATCTCGGACACCTTGAACACGCGACCGAGGAATCGTA
CAGGGTGTAACTTGCCTTCGTGTTCTTGCATAAGTGTGGTGCTCAACGCCCATTCATTCGCAAAGAGCATTACATGAACTTCCTTCGACCGATCGAAGTA
CCTGAGGATGGGTGAATGTGAAACACTCGTCTTCAACTTTTCGAAGGAACGACGTGCCACAGAAAGGCCACTTTCAACGGCAAAGTCTTCATCCTTGAGC
TGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTACTCGTAGGAA
ACGAAAGCTCGGTGATGGCCGCAAGCTTCTTGGGGTCAGCCCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGCTGGCAGAAGAT
GCTCTTGGTGAAGCTAATGCTAATCCGACACTGTGCAAATCTTGCCAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAA
ATATCATCCACAAACGACCGTCGACCAAACACAGGTACCAGCGATGATTCGTCCGGTTCCCGTTCGTAAACATGTCAGCGCCGGGGCTGTTGACGAATAG
TAGTACAGGTCGGTCTCATCGGTGTTTCGCGTTTGACCGCGAGCTTCTTTGGAAAAAGAAATCTCTCGCGTCTGTGGCCCCCGGGCTTTTCCCTGGGCCC
TTTTTTTCATTTAAAGACCCCCTCCTCCGGAAAAATCAAACAAACCCAACCTTTTTTTAAGTTGGAACGAACCCCCAGAGTGCGTTGTCGATCATACGCT
GGCAGATCATCGGCGCGTTCTTTAACTCGAAGGGCATGCGTAACCACTCGAAATGTCCGAGTGCGCAGACAAACGCCGATACTTTACGTGCTCGCAAGGT
CATCATGACCGCCCAGAAGCCGCTTGCTACATCCAGCGAGCAGAACCATAGGTAGCGCTCGAGATCTGTTAGCAGGTCGTCGACTAGCGGCATTGCATAC
TCCATGATCGCGGTGATAGACTTCACCATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTGTTCGTCACAATCACGATTGGCGATTCCCATG
GACTGTCGGAAAAGACGATCAGTTCTGCTCGCAGCAAAGCGCGCAGCAGCTCGTACAGTTTGGCGAGAAATCGTAGCGGCACGCGTCGGGCACGCTGTTT
ACTTGGGGCGTGTCCCTGTGTGTCAATATCGCATACCGCGCCGTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCTATCAGGATCTGCT