Description :
From Genome Similarity Track
Location :
Scaffold_38:42387- 48406
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_38-snap-gene-0.62Centrosomal protein of 110 kDa (Cep110 protein).
Pytap_DAOMBR444maker-pag1_scaffold_38-fgenesh-gene-0.3Carbohydrate-binding protein
Pytap_DAOMBR444maker-pag1_scaffold_38-fgenesh-gene-0.21Conserved gene of unknown function

Sequence
6019 bases(100 bases per row)
CAACTTCTTCATCGGTACTGGAGGAAAAAGACAAACTCTCAATTTCTTGCACAAGTTGCTCAACGCTCAAGCTGAATGCCTTTtCGTTGCGTTGATGGAA
GCTGCTATCACCGCCGTATAATGTGTCATTCGAATCAACACCATCAAGCCTGACTGGAATCTTCGACTGACCCCACATACCaCAAACTTGCACCAACCAG
ATCTGGACGCGAGCCCGGCAGAAaGTTGCCATTCGCTGGATGCGCTTTGGGGATCCTTCTGTATTCCAGGTCATGCGTTCAAAGAGGGCCTTGCGGAACG
CATCAAAAAaGTAAAaCGGTTCGTCATCCACAGGTGAAGGTGCCAGAAGCACCAAAGTGCAAAGATCCATCAAAACAGCTTGCACAGGATCTTCCTGATC
ATGCTTGCGAATGCCAGTATTCTTGCCAGCTTCACTCGTATCATGGAGTTCACGGTGCGACAAAGCTCTGACATAGTCAAGTTCAGCCACAGCCATGATT
GCAGACTTCAAAAATGCCTCCATTTGAGGAaGACAACAATTCTCGAGAGATACTTTCGTGCAACGAaCAAGCAGATCAAGGCGAAGAAAAGGCTCAGTAA
TCGACGGAATCGTTATGTGTGCATAGGCAAgACACGACTTgATGAAGTTACGTCGTCGATCATTAATTtGCTGCGAGTTGGgCCTTCCTTCCTGATTCAT
TCGCTTACGAACACGCATCGCTAGCGCAATCGCAAACTTGGTAAGATGACCTTTGATTGGCTCGAGCTTGTAGAAGGAGTTTCGACAATCGATGTAGAAC
ATCAGCAAAGCTTCTTCTTCCTCTTGTAGCTCAGCATCAGTTGGAGCAACCGGTGTACTGGGTGATCTTCGAGACTGCTTCGCGTACCCAAGTCGAGATA
TAAATGCCAAGATATCTCTAGTTGCGTCATTGCGTTCAGATGCTGTGCTCAATGAATCAAGAGCATCATGCACGCGACAACAGATCACAAAGAGTGTATG
TGCTACAGCAGCTTCCGGACCAACAACGTGAAGCCGAAAACTCCCAAGATTGTTCTTGGACGATTTCAATTCTTGAGTATTCACAAAAGCTTGAAGAACC
TTTTTGGCTACGCTGACACTTGACTCCCGTCgAAaCATCCCCATCAGTGTTAGAAATTCGCCGGATGGAATCAGTCGAGTAAAGAAATCGACGTGTTGTT
GAGCTCCATAGACCACGTTCTCTATGAGAGCCCCCAGCATATTGTAAACCTTCGATGTCAGTTCTTCAGGAGTAGCAGAGTTCAGATGTCGGACGACATC
TTTTAGTAAGATCATTGCCTCACGGTGAGAGTAGTGAGCAACGATGAGCTTCGTGTAAGCAGCTGCACACTCCATGTACATTTCGATATCTTCTTGAGCT
GTAATCGAGCTCCATGCCTCATTCAAGAACTGCAACTTTCCTTCTTTATTTTCGCTTCCAAATATTCTTGAGTTGCTCAACTGGATGGCGAGGACACTAT
ACAAATGGCACTTCGAATATTGGGAAGgTGTTGCCGTTCGCATCAACTGCAGCATCACTGCGGGATTCCTTGCATAGCTTGTAGCACCAAACGACTCGCA
TAGATGTTTTAACACCATCGAGTTGTCTGAATACTCACGATACTGTTCCAGAAGTGAGTCGAAAACGTCGTCAGTTGCATCCTGTGCTGTGCACTTCATG
AGCCATTCGATTGCAGGAGAATGCAGTTCGAGGTACTCGTTGTGTGAAATGTTTTGCTGATCAAGGAAGTGAGCAAGCTTTCCGGTCTCTTCAAACTGCC
GGAAAGTGAAGAAATGATCGAATACGCTGTTCAATACTGCCGTTTTATCACGTTTACTGACGAGCTCTGTGCTTGCAAGCGCAAGGTACAACCGAGTgTA
CAGAGCCACCATGGGTTCTCCAACTCCTCTGCAGGAACAACGTTTAGTGATGTGAAGCAGCCATTGGTTTGTCATACTACTGTACCtACTTTATCATGTT
GGAAATCCGCATCACAATTTGTGGGAATTCTCCGTCGCATAAGAAACGATAGCACTTCAGTAATGCAATTTCGATGTAAATGCGCGgAAGCAGCTCTCGG
ATGCAGGCTGTTTTGTAAAACCAGTTTCGACACGTCTCCTTCGCGTGGATGTTGACTTCATCACTCGTGAAATTGTCAGACAATGATGTTGGAAGTGGCT
GTCCATTTTCATCCTCCGATGCCCTTGCTTTGATTCGGTCAAaTACAAGTTGTCCAAATACATCCAAAACGTCGCTCACAAGAACAAAAGCACAAGGGTA
GAGCCGAGGTGCGGAGGACGTATCGCTTAGCTGCTTCACACACTTGATTGCGATGCGCAGAGCTTGTACTTTCAAATTTTGCTGCCATGCCTTAACCAAA
TCAGCTTCCATCTGCTTGATCCGTGCCACATACTCTTTCTGCGTGATTTCAACAATACCATTTGAAGACTTGAGCCGACTGGAGGAACTGGAGCCCGACG
TTGATGTGGCTGACGACGAAGAAAGCCCGCGCTCGAGGTGCTCAAGGCGGGCTCGAGTTTTTCTAATGACATGAAGTCCCTCCGTGGTTACAGAGGCATC
ATCATCTGCCTTCTTCTGGTATTCAGCACTTGTCGAAAAAGAAaTTTCATCTAGGCACATACAACGAGAGGTTAGCGGATAAAATAAACTACGATCCATA
GTTGCAGCATTGACGCACTTTCAATGTCGTTTGTCTCGAGCATGCTCTGTTTGAACATTTAACACGCATGAGGTTACCGTTCCTGAACCATGCGTTGAGA
TACGTACGGCTTTGATAGCAAAGGTTTCGTCTGACAATTTGGCAAGCACACGGTCCTTATGTGCCTTCCACATGAACTTGATTGTTGTGCTGTCTGCCTC
AGTCGATTGTCGAAAGGAGGCACTTCTCGTTGCCGTGCTCTTCATCGATGCCGATTCCCGACTGCCTTTGCTCTCCGATGTCTGTTCGAGGGTCAATCCC
ATGGCAAGCGCCGCCAACGGGTCGAGCTCTCCTTCAGCGAGCGCAACAACCCCGACGCTCTGTGACTTCATCAACGAGTCTGAGCCATGGAGCGTATCTC
TACTTGTTGACTTCACGACAGGCATATCATGCCTATgCGGGAGATCATCATTATCGTGGTCGCCATCGATAGTCATCGGCTCTTCTGTTAAAGGATGCAG
GCTCTCGGCGTCGACgTGGGAATAGCTGAGGTCTTCAGGACGTAGAGGCAACGTACGTTGCGTGATGCGCCATAGTACAGCGCCATTACCTCCATCTGAG
CTCATATCGCGAAGAGAAGTAGAGAACGACCTTGGCACTGCATTGCGCTCTTGCTCGCGCACTCGAGTCTCTTCCGTCGCGCTCCCCATGCGCTCTCAGG
AGACCACTGGGgTCCTCTCACTTGCTTTCTCTTCCACGGTTTCCTTGAAGATCCCCACGGCAACGAGCAAGCTTCACATCGAACTTAAGACATTTAACCG
TACTTAGTGATGCTAAGTACGAAGGAGTGGTGGTGCGTACTTAGCCTGCGCATGGCTGGGGTGTTGGCTTTGGGCGCGCCATCAGGAAGAGATAGCCCCC
GGCCcAAGGCAACACGACGGTTGAGACGCCGCTAGACGCTTTAGAGCTCGCGTGGTGAGTAGATGCGTGTGCATTCAGCATGCGTGGgtAgTATTGATCG
ATTCCTCGTTCTCAGTTtACTTGGCGGTGTGATTATCGTCTCCTTACTCTCGGTCAAaGGTGCGGAGTAATGGAGTGCCCTTGTCTtATGAAGaTGCCAA
CGCGCTGACTTGCCTTGCTTCTAGGCCTCCAGTAATCATGTTCGGCTCGACGGCAGCAAAaCCAGGGGGCTtCTCGTTtGGTGCTAGCTCGGGTGGcGCC
GCCACTGGGAGCACATTTGGAGCGCCAGCCCCTGCGGCGGGTGGCGCCGCTGGTGGTGGCTTCtCGTTTGGTGGAGGCGGTGCTGCGGCTGCTCCCAGCA
CCACCGGTTCCTCAGGCTTCAGCTTCGGTGGTGGATCCTCTGGTGCTGCTCCAGCTCCAGCTGCCGGAGGCTCAGGATTCTCGTTTGGTGGTACCAACAC
AACTACCGTAGCACCTGCGACCGGCTCAGGCTTTGGCTTCGGTTCAACCTCGACAGCGGCCCCTGCGGCAAGTGGAGGCTTCAGCTTTGGTGCTACCCCA
GCAACTAGCACTGCTGCAGCGCCAGCTGCAAGCGGAGGATTCAGTTTTGGCAGCGGTGCCACCACGGGGACGACTGCGTCATCGACCCcGGGGTTCGGCT
TCGGAGTTTGCAGCACCGCCGCGAAGCCTTCGCTCTTCGGATCGTCTGGCACCGCCGGTTCCACAGGAGGCTTCGGCTTTGGGgCGGGGgCAGCGTCAAC
TGGCACGACTTCGGCGTTCGGTGCGGCGAAGCCTGCAGGAACAGGCTTCGGCTTTGGCTCCGGATCGACTGGCGGCGCCACAGGCTCGACTGGCTTTGGT
TTCGGCAGCGGTTCCACTGGTACGACTGGCACATCGGGCTTTGGATTCGGATCCGGTACTACAGGAGCGACATCTACCGGCTTTGGCTTCGGCAGTGGCT
CCGCTGCGACAGGAGCGTCAGCATTCGGTGCTGCTCCTGCTGCGGTCACCACACCAGCCCCAATTATCATGGGCGGAGACGCCTCCGTAGCCCAATTGAA
CTCGGTCAAGTATGCCTATGAAGACCCGATGCAGTCGCGTTTCAAGTTCTTGATGTACAACACGGTGGACCCATCGCAGCGCCACTTGTATGTCCGGCCA
CCACAGATCAGTGAGCGCTTGTGGGAACAGGCGGAACAAGACAACCCGGATCCACTCAACTGCGTGCCAGTTCCGATCACCGGATTCAAGGACATCTTGA
AGCGCATTCAGGTGCAGCAGGACTACGCCGAGAAGTACAACACGTTCACAGACGATCTCCGAAAACAGCTGAAAGACATGGAGCAAATGAGCCGTACAAC
GGAGGAGAAGCTCGAAAAGTGCCGGCATGAGCACGTGCAGCTTGTGCACATGCTTGTCAAGGTGTGTATGGCTTCCTTGGGAGCTGGGCTTTGACTTTCG
GTCGCTAACGTTCATGACTTCTAGGTGATGAAAGACATTGAGTTCCTCCAGAATCTGGGCAAGCCTCTCCAGCGCGACGAAATGAACTTGGCGTGTGTTG
TTGTCTTCATTGCGTTAACAACGCTAGAATAACTAACACGTGTATGACTGATGTGCAGGATGGCGCTAAAGAAGCTACAAAAGCTCCTGGATGCCCCTGG
CCAATACAAAGCCCGACTGAATGATGCGATCGCTCTGCAGCGCATCCAGGACTCGACTCCTCCGCCTCCTTCGAACCAAATGAGCCCTGCAGACTTACAG
CGCATCTACGAGTTCCTTGACAAGCAACGCCAGGGCCTCGATCACCTCACGAACATTTTGAACGAAGACCTCGCCGACATCAAGCTCATGAAGGAGACGT
GGCGCCGATAAATGCGGTTCAACGACAGAATCTGTGGACTGACTCGATGGACGCATTCATAAACTTCAAaTTTGAGAAAGCGGGAAAGGAGAAGCAGATC
CTCAATCAAGTCGAAATGCAATCCATTCTCTCTTCTGTATTTACGTTAACAATCGCCTGCAGCGTGTGCTATGAAACCCCCTTCcGACCAAATCACCTCC
GCCGCAATCGTTCCTTGCCACAGGCACTTGTtAGAAGCGCTTGGCTTCAAAGACTTGCGTTGAGATAGAAGACCCAGGgAAGGAAGTGATCATCAGACAC
GCGGACACACGGAGAGTGCATCACGGCACCACGGCGACGGCATTTAGtGGAACGGGTCGATTGGGCCgTAGGTCTCGACGACGATTGGGGCCTCCTCGAA
CTGGTGGAGTGGTGGTGGCGACGTAAGGATCCACTCCAGGGTCTGGTGCAGCTCTGGGACCACGACCTCATCGTCGTCGTTCTGTGGTGGCGCCGCGGCG
GCGCTGAAAGCGCGCgTTG