Description :
From Genome Similarity Track
Location :
contig_46:423810- 424814
Transcript NameFunction/comments
g10106.t1XP_009519239.1 hypothetical protein PHYSODRAFT_541556 [Phytophthora sojae

Sequence
1004 bases(100 bases per row)
CACCGTCTTGTGCTCCAGGTAGTTGCGCAGACCCAGCTCGCCGTTCTCGCGCCGACGCCAGAGTCCTTGAAGCCGCCGAACGGCGTGTTCGAGTCGAACA
CGTCGTAGCAGTTCACGTACACGGTACCCGTTCGGATGCCGTTGGAGATCTTGATGGCGCTGTCGATGTTGCTCGTCACGACGCCACCGCCAAGGCCGTA
CTCCGAGTCGTTGGCACGAGCGATGACCTCGTCGATAGTCTTGAACTTGAGAATGGACATGACGGGGCCGAAGATCTCCTCACGGGCGATGGTCATGTCG
TCCTCAACATCGGCAAACACGGTGGGCTCGATGAACCAACCCTTGTCGCCCTTGCGGTGGCCACCAGCCACGAGTCGGGCGCCCTCTTCCTTGCCCTTGT
CCACGTAGCCCAAAATCTTCTTGAACTGCGCCTCATCAATCTGTGAGCCCTGGTCCGTCTTGCCGTCGAACGGGTCACCAACAATACGAGCGTTTGCGGC
CTCGGCGGAGCGCTTCACGAACTCGTCGTAGATACCCTCTTGCACAAACACGCGCGTGCCCGAAATGCAGCACTGGCCCTGGTTCATGAACAGACCCAGC
TGCGACTGCTTGATGGCGAGATCGATATCGGCGTCGTCCAGGATGATGTTGGCCGACTTGCCACCAAGCTCCAGGGTGATACGCTTGAGGTTGCTCACGT
GCGAGGTGCGCATGATCTGGTACCCGACTTCCGTCGATCCGGTAAATGCAACCTTGTCCACTTTGGGGTGCTGGGCCAGGTGGCGGCCAGCGTTGGCGCC
CACTCCGGGGACAATGTTCACCACACCCTTAGGGAAACCAGCCTCCACGATCAACTCACCAACGCGCAGAGCAGACAGAGCAGTCTGTTCGGCGGGTTTC
AACACAATGGTGTTGCCGGCAGCGAGAGCAGGGCCCAGCTTCCACGCCATCATGAGCAGCGGGAAGTTCCACGGGATGATCTGCGCGCACACACCGACGG
GTTC