Description :
From Genome Similarity Track
Location :
Scaffold_396:4238- 5592
Transcript NameFunction/comments
Hyaar_Emoy2814011hypothetical protein

Sequence
1354 bases(100 bases per row)
GATGCTTGAGCGCAAGGGATTTCTTCACCGGAAGAAGTCTCGTACTGGAGATACGGCCTAAGGCGACCGATGTAGAACGTAGGATGCGTGCGCATCTTCA
CGTGGAAGTTCAGTCGTATATGCGTTGCCTAGGCGGCACATCACACGAAATGGACCGATGAACTTGGGTAGTAACTTGTTACTACCCACGTTAGTCACTA
TGTGTCGAGGTGACTTTACCGTAGATATTAGGAGTAGGTCACCTTCATTGAATGAAAGAACGTTTGCTCTTCCATTCTTGTCAGCGTTTTTCTTTTGTCA
GTCCACCGCTTCTGCAATGGAATCTTGCACGAAACGGACAACCGTTTCGCGAGCCAGTATGAATTCATCTGCTGGATCTCTGTCTTTGGCTATAGTGCGC
TTGGAGCGCACTGCGGCAATATCAGTGACCTGGGTAGTAAGAGCACCCTCGCTCTTACTTTCCTCTTCTTCACCGAAGTCGATGTGATCGACATCGGCGT
CATACGTAGTGACCTCGTGGTTAGTGCGTGATGAGTGAGAGCCGAGTTGGCGTTCGCTCGAATGATTCCCCCCCTCAAACTAGATTTACCCTCAAAAAGG
TGGGTAGGCGTGGGTGCGCAAGCCATTCACGAAGAACGGTGTATGCGACGTCGGTGCATGCACCGAGTTGTTGATGGCGAATTCCACCATTGGAAAGAAT
TCGCTCCAATTCGTAAACGAATGGACATAACCCCGAAGGAGCTTCTTAAGAACGCGGTTTGCACGTTCTGTCTGACCATCTGTTTCAGGGTGGTCAGAGA
TAGACATCTGAAGGCGTGTTCCGAGTGTTTTGAACACGGATCGCCAGAATTCCGCAGTGAACCGTGGATCTCGGTCGGAGACGAGTTCACGAGGCAACCG
ATGAAGACGACAGATCGTGTCAACAAAAACACGAGCACATGCTGATGCATTGATAGATTCAGGTACAGCGACCAGGTATACCATTTTACTGAATATATCA
ACGAACACAAGAATACCTGTATTCTTGTGTGGGTCTGCGGGGAATCCAAAGACAAAGTCCATTGAGACTGATTCCCAGAATTCTGCCGCAATGGGCAAGG
GTTGCAACGGCGCACGAAGTGAAGGATCTGACTTCAATCGTTGACATACTTCGCATGCGCGGACTTACTTTCTCACGAACTGATACTGGAGGGGCCAGTA
AAAGTCGCGACTAACTGTGAGATATGTCTTCTCTCGACCACGATGTTCACCAGTAGGTGCATCGTGGTACTTATACATGATGCGCAGTCGCAGGTTACCA
TGGTCCAGTACGACGACACGAGGTGTCTCGCCGGCAACGGCTGTATACGTCAGC