Description :
From Genome Similarity Track
Location :
contig_46:423785- 425182
Transcript NameFunction/comments
g9642.t1hypothetical protein

Sequence
1397 bases(100 bases per row)
CACCGTCTTGTGCTCCAGGTAGTTGCGCAGACCCAGCTCGCCGTTCTCGCGCCGACGCCAGAGTCCTTGAAGCCGCCGAACGGCGTGTTCGAGTCGAACA
CGTCGTAGCAGTTCACGTACACGGTACCCGTTCGGATGCCGTTGGAGATCTTGATGGCGCTGTCGATGTTGCTCGTCACGACGCCACCGCCAAGGCCGTA
CTCCGAGTCGTTGGCACGAGCGATGACCTCGTCGATGGTCTTGAACTTGAGAATGGACATGACGGGGCCGAAGATCTCCTCACGGGCGATGGTCATGTCG
TCCTCAACATCGGCAAACACGGTGGGCTCGATGAACCAACCCTTGTCGCCCTTGCGGTGGCCACCAGCCACGAGTCGGGCGCCCTCTTCCTTGCCCTTGT
CCACGTAGCCCAAAATCTTCTTGAACTGCGCCTCATCAATCTGTGAGCCCTGGTCCGTCTTGCCGTCGAACGGGTCACCAACAATACGAGCATTTGCGGC
CTCGGCGGAGCGCTTCACGAACTCGTCGTAGATACCCTCTTGCACAAACACGCGCGTGCCCGAAATGCAGCACTGGCCCTGGTTCATGAACAGACCCAGC
TGCGACTGCTTGATGGCGAGATCGATATCGGCGTCGTCCAGGATGATGTTGGCCGACTTGCCACCAAGCTCCAGGGTGATACGCTTGAGGTTGCTCACGT
GCGAGGTGCGCATGATCTGGTACCCGACTTCCGTCGATCCGGTAAATGCAACCTTGTCCACTTTGGGGTGCTGGGCCAGGTGGCGGCCAGCGTTGGCGCC
CACTCCGGGGACAATGTTCACCACACCCTTAGGGAAGCCAGCCTCCACGATCAACTCACCAACGCGCAGAGCAGACAGAGCAGTCTGTTCGGCGGGTTTC
AACACAATGGTGTTGCCGGCAGCGAGAGCAGGGCCCAGCTTCCACGCCATCATGAGCAGCGGGAAGTTCCACGGGATGATCTGCGCGCACACACCGACGG
GTTCGGCTTTCGTGTAGCAAAGGTAGGGGCCTGACACGGGGATGACGGAGCCGTGGATCTTGTCGGGCCAGCCGGCGTAGTAGCGGAGAGTCTTCAGCAC
CAACTTCACGTCGTTCTCCTTGGCGACATGGAATGGCTTGCCATTGTCGAGCGCCTCAAGAGCGGCAATCTCGTCAATGTTCTCTTCAATCAGGTCCGCC
AGCCTGTAGATGAGCTTACCCCGGGCTTCGGCAGACATGGTGCGCCACGGTCCCTCGAACGCGTCGCGAGCAGCAGCCACAGCAGCATCGATGTCCGCGT
TGACGGCCTCTGACACGTCGGCGATCTTCTCCTCCGTGGCGGGGTTGAACGTCTCGAACGTGCGGCCGCTGGACGAAGGCACGAACTCGCCGTTGAT