Description :
From Genome Similarity Track
Location :
Scaffold_276:42378- 45808
Sequence
3430 bases(100 bases per row)
TCTCGCCTTCTTCAGCACAAGGCACTGCTCCACATCGGCACTTGATATACCACCATCCTCACGCCGTACTGACGCTCTCTTCACCAGTACCATGCAGGCC
GGCTTCTATACTGCGTCATTGAATGTCGGACAAGCCGGCGCGCTCGAAGCAAACTAAGGCCACAACAAGTTTACACGACTTCCTCATAGCGAGAGGCTAT
CTCGCCACCCGCCATCGATGAACACGTTGCCTACTGCTCCTTGAACGTTTGCAGACCCGGTGATCTTCACTTTCTGCTGATTCCAAACTAGATACACTTC
CGCAACGGAGCTTCACATTAACACCGGCTACACTGCTGTCGCACTGGACGAGGCACAGGCTGCATCCCGACCCCTTGCTGCCAGCCGTAACGCTACCAAG
GTCACCGCTTGACATAGTCACTTCGCCGCCAACATCGCTCGATGACGAGACGTCAGACACACCAACAGCTTCTCCAGACCCACTCGCTGAAGACGAACCG
CCTTCCACCGACCCGGAAGATCCCGCTTGCGACTCACCGCCACCCACGACAACATTCTCGATGTCGCCGTGTCAACAGAGCCGTCCAAAACGCTCTTCAA
GCCAGGACACTGTGTTGATTTAGCCAGTAGGCATAAGCACGAGTATTGTCATCCTGCGTGTCACCCAACAAAATTGACACATCACCCGACGCAGATATTG
CACTTGCTGCCCCGACATAAGGCCGCCACGTTCGACATGCCATCCATTCGTCTCACTACTGGAGTCTCTACTGCTGCTATCACCGGGAACACTCTGGCCA
CCACCGTGTCCGCTTGCACCTTGGCGGCACTGTACATTACGTGACCGAGGGTTCGTCGCTTGAGCATCTTAGGCGGTGTCGCGTTATTGTCAACGGGCGA
TTATCCGCAATTATGGAGAAATCACTACAGCACACATGTGGCCGCTTATATGATTGATGTTCGGCAGGCAGTGAGCAGGAATCGGCACTGGACGAGGAAA
CTAAAAAAGGCCGATGGCGAAGCGGTCTCCGCAGACGACACGACCACGATCACTAACGCCGTGCAGCCGTTGTCGATCGCAGTGGTCGGAATGCTAGCAA
GAGTGAGTTTAATGAGCATCACCGACATAGAGCTGGCGAGGAATCAAAGGGTCAGCAACAGGAGCTCGAGCCGAAGTGGGCGCCGGCAGCAGCGGTTGCT
TAGCTACAACCAGCGCTCCAGATGACGGGAGCCACTCCGGTACAACAAAGCAGCCGAAGAACGTGACGCTGTGGAGGAATAGGGCGAACACGGATGTGAT
GGAGAACAGCAAGGTGCCGGGCATGATCAGAACGATGACCATGATGGAGAACGCCGCGCACAAGACGAGGATGGACCGTGGCAACCAACACGGGCGAGAC
CAGCACGATAATCGTGGAGAACGGTGGTGGCCAGAGTGTTCCCGGTGATAACAGCAGTAGAGACTCCAGTAGTGAGACGAATGGATGGCATGTCGAACGT
GGCGGCCTTATGTCGGGGCAGCAAGTGCAATATCTGCGTCGGGTGATGTGTCAATTTTGTTGGGTGACACGCAGGATGACAATACTCGTGCTTATGCCTA
CTGGCTAAATCAACACAGTGTCCTGGCTTGAAGAGCGTTTTGGACGGCTCTGTTGACACGGCGACATCGAGAATGTTGTCGTGGGTGGCGGTGAGTCGCA
AGCGGGATCTTCCGGGTCGGTGGAAGGCGGTTCGTCTTCAGCGAGTGGGTCTGGAGAAGCTGTTGGTGTGTCTGACGTCTCGTCATCGAGCGATGTTGGC
GGCGAAGTGACTATGTCAAGCGGTGACCTTGGTAGCGTTACGGCTGGCAACAAGGGGTCGGGATGCAGCCTGTGCCTCGTCCAGTGCGACAGCAGTGTAG
CCGGTGTTAATGTGAAGCTCCGTTGCGGAAGTGTATCTAGTTTGGAATCAGCAGAAAGTGAAGATCACCGGGTCTGCAAACGTTCAAGGAGCAGTAGGCA
ACGTGTTCATCGATGGCGGGTGGCGAGATAGCCTCTCGCTATGAGGAAGTCGTGTAAACTTGTTGTGGCCTTAGTTTGCTTCGAGCGCGCCGGCTTGTCC
GACATTCAATGACGCAGTATAGAAGCCGGCCTGCATGGTACTGGTGAAGAGAGCGTCAGTACGGCGTGAGAATGGTGGTATATCAAGTGCCGATGTGGAG
CAGTGCCTTGTGCTGAAGAAGGCGAGATATACGCTGCGTATATGGGTGATGCTGTGCATTACGTAGAACTTGGTGAAGAAGGCGCCCGAGGTGACGAAAA
TGACGGTGTACTTGATGCTAATCAAGGTTTGCAAGATGGCGCACAGAACGGTCGACATGACAGATGTGATTTGCCGAAAAAGCTATTATGGAAGGGGTTA
CATGTCATTACAGGGTCCTAAAACACGTGGGTCAGATCGAACTCGTTGATAAGGACATGACGAAGTCCCGTGTGAAACGAAACCTCGCGTGTAAGTAGAG
GAAGCGTGCATAAGTCGAACGTTTAATAACTATGGCAGCCGACGAACAGGTAGCAACAGCGCTGTGGCGACGCAGGGATGCAAGATACAGCCGACAACAA
GAGATGACCAAATGACGGCAAACGGCGTTTGCCTACAGTAATGACGACTGAAGAAGCAAAAAAATTGCTGTAACGATAACCGAGAGTGTGGGTGGCATCC
GACGTAAGCGTGAAAGTCGATGCGGGATCTGTGATGCCGCTAGTGACGACCTGAACGAGAATACGGGTAGTGAGTAATCGGCAGCTCCAAAAGGTGGTCA
TGGATGAAGAGCTGAAACCACGATGTAGCTAGGAAGGTCTGAGTGGACCCGGGTTGACGAAGGGAGCAAAGTGTGGATGGAAGTGGCGTCTTGGCACGAA
AAAGACGATTCGATGGTGACAGCTAGTATCAAGGGGACGGTACGAGCGGCGTCAGTTATCGGAGTCCCAGTACGACCGATTATACAGGGACGTCAGAGTC
GTGGAAGACTCTGGAATTGAAGAAGACGAGTATCAGGGTATTATTACGAGGGCAGGTGAAGTGACTACGGAAGCTTAGCCGTTGGTGATGGACGGCACAA
ACGTGTATGCGGTGAACGAGTACAAGGGGCTACGCAGCGAATTACAAGCCGGGTGAGGATACGGGTTCCGTGTACATGTATAGTGACGCTGGTACGCGAT
TTACACAACGACGGATGCGTGTTCAAGAATGGACAAGAAGGACGTATACGCGAAGACCAGCACGTTGAAGATAGAAGATGACGTCGTGTGGCAGATGGCA
AAGTCATTGGGTTAACGTGAGAGGAGCAGGTCCCACGGTACAGAGAGAGCAGAACGACTCGGCGCAGCAGTTGCCGTGGCCGGTCAGAGAGGCTGTCAGG
GGCAGTTGCAGGGTATGTCTAAAGAGGTGG